SFBB, SFBB (gene) Eriobotrya japonica

Gene Overview
Name SFBB
Gene Symbol SFBB
Type gene
Organism Eriobotrya japonica
Synonym S-haplotype-specific F-box brother 1b
S-haplotype-specific F-box brother 1a
S-haplotype-specific F-box brother 8
S-haplotype-specific F-box brother 4
Description NA
Comment S-haplotype-specific F-box from the RNase-dependent gametophytic self-incompatibility fertilization system
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBKC479162.1-SFBBEriobotrya japonicagene
SFBBKC479161.1-SFBBEriobotrya japonicagene
SFBBKC479160.1-SFBBEriobotrya japonicagene
SFBBKC479159.1-SFBBEriobotrya japonicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBKC479162.1-SFBB.m1Eriobotrya japonicamRNA
SFBBKC479161.1-SFBB.m1Eriobotrya japonicamRNA
SFBBKC479160.1-SFBB.m1Eriobotrya japonicamRNA
SFBBKC479159.1-SFBB.m1Eriobotrya japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBEriobotrya japonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC479162.1-SFBB N/A KC479162.1
gene parsed from NCBI nr database KC479161.1-SFBB N/A KC479161.1
gene parsed from NCBI nr database KC479160.1-SFBB N/A KC479160.1
gene parsed from NCBI nr database KC479159.1-SFBB N/A KC479159.1
mRNA parsed from NCBI nr database KC479162.1-SFBB.m1 N/A KC479162.1
mRNA parsed from NCBI nr database KC479161.1-SFBB.m1 N/A KC479161.1
mRNA parsed from NCBI nr database KC479160.1-SFBB.m1 N/A KC479160.1
mRNA parsed from NCBI nr database KC479159.1-SFBB.m1 N/A KC479159.1

Sequence(s):
>KC479162.1-SFBB1188
atgtctcaggtgcgtgaaagtgaaactcctgaagatagggtggtcgaaacactgtctaggttgccgcccaagtctttgat
gcgattcaaatgcatacgcaagtcttggtgcattctcatcagtactccaagttttgttgccaaacacctcaacaattcta
tgaacaacaaactatcgtcctccagttgcatccttctcaaccgttgtcagaatcatgttttcccggatagaagttggaaa
ccagaagttttctggtccataattaatctttccattgatagtgatgatcacaaccttcattatgatgttgaggacctcaa
tataccgtgtccattggaaggtcatgattttgtagagattggtggctattgcaatgggattgtctgtgtactagcatgga
aaactcttcattggatatatgttattttatgcaatcctgcaactagggaatttaggcaacttccccattcatgccttctt
caaccttcccgttctaggagaaaatttcaattgaacacgatctctacattattgggatttggttatgattgcaaagctaa
agaatacaaggtcgtgcaagttattgaaaattgtgagtattcagatgctgagcaatacgattatcatcgtatcgctcttc
ctcacacagctgaggtatataccacgactgctaactcttggagagagatcaagattgatatatcaggtgaaacctattgt
tatacttgttcagtgtacttgaatggattttgtttttggattgcaaccgatgaagaagatttcatactttcatttgattt
aggtgatgagatatttcatagaatacaattgccttctagaarggaattcggttttacgttttatggtctttttctatata
atgaatccatcacttcttattgcactcgttatgatccaagtgaaggttttaaactatttgaaatatgggtaatggacaac
tatgacggagtaaagagttcatggataaaactcttaaccgttggaccttttaaaggcattcagtatccattgacactttg
gaaatgtgacgagcttcttatgcttgcctcctgtggaagagtcacctcatataattctagtaccgaaaatctgaagtatg
ttcatattcctcctattattaataggattataaattttcaagctcttgtttatgtngaaagtattgtt
back to top
>KC479161.1-SFBB1191
atgtcccaggtgtgtgaaagtgaaactcctgaagacagggtggtcgaaacactgtctaggttgccgcccaagtctttgat
gcgattcaaatgcatacgcaggtcttggtgcattctcatcagtactccaagttttgttgccaaacacctcaacaattcta
tgaacaacaaactatcgtcctccagttgcatccttctcaaccgttgtcagaatcatgttttcccggatagaagttggaaa
ccagaagttttctggtccataattaatctttccattgatagtgatgatcacaaccttcattatgatgttgaggacctcaa
tataccgtgtccattgggaggtcatgattttgtagagattggtggctattgcaatgggattgtctgtgtactagcatgga
aaactcttcattggatatatgttattttatgcaatcctgcaactagggaatttaggcaacttccccattcatgccttctt
caaccttcccgttctaggagaaaatttcaattgaacacgatctctacattattgggatttggttatgattgcaaagctaa
agaatacaaggtcgtgcaagttattgaaaattgtgagtattcagatgctgagcaatacgattatcatcgtatcgctcttc
ctcacacagctgaggtatataccacgactgctaactcttggagagagatcaagattgatatatcaggtgaaacctattgt
tatacttgttcagtgtacttgaatggattttgtttttggattgcaaccgatgaagaagatttcatactttcatttgattt
aggtgatgagatatttcatagaatacaattgccttgtaggagagaatctgattttcggttttctaatctttttctgtgta
ataaaacgattgcttcttttggctcttgttgcaatccaagtgatgaggattctacattatatgaaatatgggtaatggat
gattatgacggagttaaaagttcatggacaaaactcttaacctttggacccttaaaaggcattgaaaatctgtttacatt
ttggaaaacagatgagcttcttatggaaacctctggtggaacagccagctcttatacttccagtaccggaaatctcaact
atcttcatattcctcctattctcaatcaagttagagcttttaaagctctaatttatgtggaaagtattgtt
back to top
>KC479160.1-SFBB1180
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaatggtcgaaatcttgtccaggttgccacccaagtctctaat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tgggcaacaaactctcatcctccacttgtatccttcttaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaaattttatggtctgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccatcatgaagtagagattcacggttattgcgacgggattgtttgtataacagtggacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctgccccttcccggggta
aaagaaaaattcggattggaaacgacacttaagggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcgcgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggctgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcactagttacgaagagccttccacattatttgaaatatgggtaatggactac
aacgacggatttaagagttcatggacaaaacacctaactgctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattacctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatgagaatagggttgtagattacgtgaaaagtattattc
back to top
>KC479159.1-SFBB1174
atgtctcaggtgcgtgaaactgaaacttctgaagatagggtggtttcaatcatgtccaagttgccgcccaaatctttgat
gcgattcaaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattctg
tcgacaacaaattctcatcctccacttgtatccccctcaaccgttctcaggttcacgttttcccggacaagagttggaaa
catgaagttttatggtccatgattaatttttttaatgatagagttgcacgcgccctttattatgatgttgaggacctaaa
tataccgtttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtctgtgtaatatcaggga
aaaatattcttttatgcaaccccgcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctt
ggcggaaaattcgaattggaaaccgattttggaggattgggatttggctatgattgcagagctaaagattacaaggttgt
gcgaattatagaaaattgtgagtattcagatgatgagcgaacatattatcatcgtattcctctgcctcacacagctgagg
tatacaccatgggtactaactcttggaaagagatcaagattgatatatcaagtaaaacttatccctgttcttgttcagtg
tacttgaagggattttgttattggtttacaagggatggtgaggaattcatactttcatttgatttaggcgatgagagatt
tcatagaatacaattgccttcaaggagagaatccggtttggagttttattatatttttctgtgtaatgaatccattgctt
ctttttgctctctttacgatggaggtgaagattctaaattatgtgaaatatgggtaatggacgactatgatggagtcaag
agttcatggacaaaactcctagtcgctggaccctttaaaggcattgagaagccattgacattttggaaatgtgacgagct
tcttatgcttgacaccaatggaagagtcatctcttataattctagtattggatatctcagctatcttcatattcctccga
ttatcaattgggttatagattctcaagctcttacttatatagaaagtattgttc
back to top
>KC479162.1-SFBB.m11188
atgtctcaggtgcgtgaaagtgaaactcctgaagatagggtggtcgaaacactgtctaggttgccgcccaagtctttgat
gcgattcaaatgcatacgcaagtcttggtgcattctcatcagtactccaagttttgttgccaaacacctcaacaattcta
tgaacaacaaactatcgtcctccagttgcatccttctcaaccgttgtcagaatcatgttttcccggatagaagttggaaa
ccagaagttttctggtccataattaatctttccattgatagtgatgatcacaaccttcattatgatgttgaggacctcaa
tataccgtgtccattggaaggtcatgattttgtagagattggtggctattgcaatgggattgtctgtgtactagcatgga
aaactcttcattggatatatgttattttatgcaatcctgcaactagggaatttaggcaacttccccattcatgccttctt
caaccttcccgttctaggagaaaatttcaattgaacacgatctctacattattgggatttggttatgattgcaaagctaa
agaatacaaggtcgtgcaagttattgaaaattgtgagtattcagatgctgagcaatacgattatcatcgtatcgctcttc
ctcacacagctgaggtatataccacgactgctaactcttggagagagatcaagattgatatatcaggtgaaacctattgt
tatacttgttcagtgtacttgaatggattttgtttttggattgcaaccgatgaagaagatttcatactttcatttgattt
aggtgatgagatatttcatagaatacaattgccttctagaarggaattcggttttacgttttatggtctttttctatata
atgaatccatcacttcttattgcactcgttatgatccaagtgaaggttttaaactatttgaaatatgggtaatggacaac
tatgacggagtaaagagttcatggataaaactcttaaccgttggaccttttaaaggcattcagtatccattgacactttg
gaaatgtgacgagcttcttatgcttgcctcctgtggaagagtcacctcatataattctagtaccgaaaatctgaagtatg
ttcatattcctcctattattaataggattataaattttcaagctcttgtttatgtngaaagtattgtt
back to top
>KC479161.1-SFBB.m11191
atgtcccaggtgtgtgaaagtgaaactcctgaagacagggtggtcgaaacactgtctaggttgccgcccaagtctttgat
gcgattcaaatgcatacgcaggtcttggtgcattctcatcagtactccaagttttgttgccaaacacctcaacaattcta
tgaacaacaaactatcgtcctccagttgcatccttctcaaccgttgtcagaatcatgttttcccggatagaagttggaaa
ccagaagttttctggtccataattaatctttccattgatagtgatgatcacaaccttcattatgatgttgaggacctcaa
tataccgtgtccattgggaggtcatgattttgtagagattggtggctattgcaatgggattgtctgtgtactagcatgga
aaactcttcattggatatatgttattttatgcaatcctgcaactagggaatttaggcaacttccccattcatgccttctt
caaccttcccgttctaggagaaaatttcaattgaacacgatctctacattattgggatttggttatgattgcaaagctaa
agaatacaaggtcgtgcaagttattgaaaattgtgagtattcagatgctgagcaatacgattatcatcgtatcgctcttc
ctcacacagctgaggtatataccacgactgctaactcttggagagagatcaagattgatatatcaggtgaaacctattgt
tatacttgttcagtgtacttgaatggattttgtttttggattgcaaccgatgaagaagatttcatactttcatttgattt
aggtgatgagatatttcatagaatacaattgccttgtaggagagaatctgattttcggttttctaatctttttctgtgta
ataaaacgattgcttcttttggctcttgttgcaatccaagtgatgaggattctacattatatgaaatatgggtaatggat
gattatgacggagttaaaagttcatggacaaaactcttaacctttggacccttaaaaggcattgaaaatctgtttacatt
ttggaaaacagatgagcttcttatggaaacctctggtggaacagccagctcttatacttccagtaccggaaatctcaact
atcttcatattcctcctattctcaatcaagttagagcttttaaagctctaatttatgtggaaagtattgtt
back to top
>KC479160.1-SFBB.m11180
atgtctcaggtgtgtgaaagtgaaactcctgaagatagaatggtcgaaatcttgtccaggttgccacccaagtctctaat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tgggcaacaaactctcatcctccacttgtatccttcttaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaaattttatggtctgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccatcatgaagtagagattcacggttattgcgacgggattgtttgtataacagtggacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctgccccttcccggggta
aaagaaaaattcggattggaaacgacacttaagggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcgcgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggctgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcactagttacgaagagccttccacattatttgaaatatgggtaatggactac
aacgacggatttaagagttcatggacaaaacacctaactgctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattacctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatgagaatagggttgtagattacgtgaaaagtattattc
back to top
>KC479159.1-SFBB.m11174
atgtctcaggtgcgtgaaactgaaacttctgaagatagggtggtttcaatcatgtccaagttgccgcccaaatctttgat
gcgattcaaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattctg
tcgacaacaaattctcatcctccacttgtatccccctcaaccgttctcaggttcacgttttcccggacaagagttggaaa
catgaagttttatggtccatgattaatttttttaatgatagagttgcacgcgccctttattatgatgttgaggacctaaa
tataccgtttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtctgtgtaatatcaggga
aaaatattcttttatgcaaccccgcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctt
ggcggaaaattcgaattggaaaccgattttggaggattgggatttggctatgattgcagagctaaagattacaaggttgt
gcgaattatagaaaattgtgagtattcagatgatgagcgaacatattatcatcgtattcctctgcctcacacagctgagg
tatacaccatgggtactaactcttggaaagagatcaagattgatatatcaagtaaaacttatccctgttcttgttcagtg
tacttgaagggattttgttattggtttacaagggatggtgaggaattcatactttcatttgatttaggcgatgagagatt
tcatagaatacaattgccttcaaggagagaatccggtttggagttttattatatttttctgtgtaatgaatccattgctt
ctttttgctctctttacgatggaggtgaagattctaaattatgtgaaatatgggtaatggacgactatgatggagtcaag
agttcatggacaaaactcctagtcgctggaccctttaaaggcattgagaagccattgacattttggaaatgtgacgagct
tcttatgcttgacaccaatggaagagtcatctcttataattctagtattggatatctcagctatcttcatattcctccga
ttatcaattgggttatagattctcaagctcttacttatatagaaagtattgttc
back to top