SFBB, SFBB (gene) Pyrus sinkiangensis

Gene Overview
Name SFBB
Gene Symbol SFBB
Type gene
Organism Pyrus sinkiangensis
Synonym SFBBV2-gamma
SFBBV-gamma
SFBBx-gamma
Description NA
Comment may be involved in control of plant self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBGQ456946.1-SFBBPyrus sinkiangensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBGQ456946.1-SFBB.m1Pyrus sinkiangensismRNA
SFBBGQ456943.1-SFBB.m1Pyrus sinkiangensismRNA
SFBBKU756268.1-SFBB.m1Pyrus sinkiangensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus sinkiangensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GQ456946.1-SFBB scaffold01086:55112..56303
GQ456946.1
mRNA parsed from NCBI nr database GQ456946.1-SFBB.m1 scaffold01086:55112..56303
GQ456946.1
mRNA parsed from NCBI nr database GQ456943.1-SFBB.m1 scaffold01086:55112..56303
GQ456943.1
mRNA parsed from NCBI nr database KU756268.1-SFBB.m1 N/A KU756268.1

Sequence(s):
>GQ456946.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattactcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcaatgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
cgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggacctttcacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top
>GQ456946.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattactcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcaatgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
cgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggacctttcacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top
>GQ456943.1-SFBB.m11191
atgtctcaggtgcgtgaaagtggaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcttacgcaaatcttggtgcactcttatcaatagcccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccctcatgaagtagagatgcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacgcttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtgttcagatgatggagaaacatatgttgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattatcgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagatcacgtaaaaagtattattctagtcaattga
back to top
>KU756268.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaattttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacactatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaatttggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top