SFBB, SFBB (gene) Pyrus x bretschneideri

Gene Overview
Name SFBB
Gene Symbol SFBB
Type gene
Organism Pyrus x bretschneideri
Synonym SFBB-1
SFBB-23
SFBB-13
SFBB-III
SFBBb-gamma
SFBBa-alpha
Description NA
Comment may be related to the control of plant self-incompatibility
may be involved in control of plant self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBGU901410.1-SFBBPyrus x bretschneiderigene
SFBBGU901408.1-SFBBPyrus x bretschneiderigene
SFBBGU901407.1-SFBBPyrus x bretschneiderigene
SFBBGU901406.1-SFBBPyrus x bretschneiderigene
SFBBGQ456947.1-SFBBPyrus x bretschneiderigene
SFBBGQ456945.1-SFBBPyrus x bretschneiderigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBGU901410.1-SFBB.m1Pyrus x bretschneiderimRNA
SFBBGU901408.1-SFBB.m1Pyrus x bretschneiderimRNA
SFBBGU901407.1-SFBB.m1Pyrus x bretschneiderimRNA
SFBBGU901406.1-SFBB.m1Pyrus x bretschneiderimRNA
SFBBGQ456947.1-SFBB.m1Pyrus x bretschneiderimRNA
SFBBGQ456945.1-SFBB.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU901410.1-SFBB scaffold01086:55112..56303
GU901410.1
gene parsed from NCBI nr database GU901408.1-SFBB scaffold01086:55112..56303
GU901408.1
gene parsed from NCBI nr database GU901407.1-SFBB scaffold01086:55112..56303
GU901407.1
gene parsed from NCBI nr database GU901406.1-SFBB scaffold01086:55112..56303
GU901406.1
gene parsed from NCBI nr database GQ456947.1-SFBB scaffold01086:55112..56303
GQ456947.1
gene parsed from NCBI nr database GQ456945.1-SFBB scaffold01086:55112..56303
GQ456945.1
mRNA parsed from NCBI nr database GU901410.1-SFBB.m1 scaffold01086:55112..56303
GU901410.1
mRNA parsed from NCBI nr database GU901408.1-SFBB.m1 scaffold01086:55112..56303
GU901408.1
mRNA parsed from NCBI nr database GU901407.1-SFBB.m1 scaffold01086:55112..56303
GU901407.1
mRNA parsed from NCBI nr database GU901406.1-SFBB.m1 scaffold01086:55112..56303
GU901406.1
mRNA parsed from NCBI nr database GQ456947.1-SFBB.m1 scaffold01086:55112..56303
GQ456947.1
mRNA parsed from NCBI nr database GQ456945.1-SFBB.m1 scaffold01086:55112..56303
GQ456945.1

Sequence(s):
>GU901410.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggttgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctagtgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatggataatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>GU901408.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcttccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>GU901407.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcttacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccctcatgaagtagagatgcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatgttgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtaaaaagtattattctagtcaattga
back to top
>GU901406.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacatgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcgtatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttatagatatggagtttccattgacaccttg
gaaacgtgatgagcttcttatgattgcttccgatggaagagctgcctcttataattcttgtaccggaaatttcaaatatc
ttcatattcctgttattattaatcagaatagggttgtcgattacgtgaaaagtattattctagtcaattga
back to top
>GQ456947.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggtgttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tttataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcttccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>GQ456945.1-SFBB1191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattactcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcaatgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
cgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggacctttcacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top
>GU901410.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggttgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctagtgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatggataatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>GU901408.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcttccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>GU901407.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcttacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccctcatgaagtagagatgcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatgttgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtaaaaagtattattctagtcaattga
back to top
>GU901406.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacatgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcgtatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttatagatatggagtttccattgacaccttg
gaaacgtgatgagcttcttatgattgcttccgatggaagagctgcctcttataattcttgtaccggaaatttcaaatatc
ttcatattcctgttattattaatcagaatagggttgtcgattacgtgaaaagtattattctagtcaattga
back to top
>GQ456947.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggtgttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tttataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcttccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>GQ456945.1-SFBB.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattactcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcaatgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
cgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggacctttcacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top