SFBC, SFBC (gene) Prunus salicina

Gene Overview
Name SFBC
Gene Symbol SFBC
Type gene
Organism Prunus salicina
Synonym S haplotype-specific F-box protein c
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBCAB280792.1-SFBCPrunus salicinagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBCAB280792.1-SFBC.m1Prunus salicinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus salicinagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB280792.1-SFBC N/A AB280792.1
mRNA parsed from NCBI nr database AB280792.1-SFBC.m1 N/A AB280792.1

Sequence(s):
>AB280792.1-SFBC1128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtacaagcaagtcttggagtgatttgattggcagctcgagttttgttagcacacaccttcatagaaatgacacaatac
atgcccacgtctatctactttgcctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtctcttttctccaatgaaacatttgagaagtgctttgagttaagacaccccttagggagcacagaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaatccatcgatcaggaaatttaggacccctccaatgagcaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccacccccgggttaatgactacaagattataagaatgatgcgtaccaacaaagatgccttcaccgttgaggt
ttatagtcttggaacagactcttggaagatgattgaagcaatcccgccctggttaaaatgcacttggcagcatcaaatgg
gtacattttctaatggtgtagcataccacatcattcagaaaggtcctatattcagcgttatctcattcgattcagacagt
gaagaattccaagaattcatagcaccagatgccatttgcagttcatgggggttatgtatcaacgtttacaaggaacaaat
ttgcttgctttttagattttatggttgtgaggaggagggcatggaacaagttgacttctgggttctacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>AB280792.1-SFBC.m11128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtacaagcaagtcttggagtgatttgattggcagctcgagttttgttagcacacaccttcatagaaatgacacaatac
atgcccacgtctatctactttgcctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtctcttttctccaatgaaacatttgagaagtgctttgagttaagacaccccttagggagcacagaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaatccatcgatcaggaaatttaggacccctccaatgagcaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccacccccgggttaatgactacaagattataagaatgatgcgtaccaacaaagatgccttcaccgttgaggt
ttatagtcttggaacagactcttggaagatgattgaagcaatcccgccctggttaaaatgcacttggcagcatcaaatgg
gtacattttctaatggtgtagcataccacatcattcagaaaggtcctatattcagcgttatctcattcgattcagacagt
gaagaattccaagaattcatagcaccagatgccatttgcagttcatgggggttatgtatcaacgtttacaaggaacaaat
ttgcttgctttttagattttatggttgtgaggaggagggcatggaacaagttgacttctgggttctacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top