SFBF, SFBF (gene) Prunus dulcis

Gene Overview
Name SFBF
Gene Symbol SFBF
Type gene
Organism Prunus dulcis
Synonym S haplotype-specific F-box protein f
S haplotype-specific F-box Protein f
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBFAB480705.1-SFBFPrunus dulcisgene
SFBFAB480704.1-SFBFPrunus dulcisgene
SFBFAB361036.1-SFBFPrunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBFAB480705.1-SFBF.m1Prunus dulcismRNA
SFBFAB480704.1-SFBF.m1Prunus dulcismRNA
SFBFAB361036.1-SFBF.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB480705.1-SFBF N/A AB480705.1
gene parsed from NCBI nr database AB480704.1-SFBF N/A AB480704.1
gene parsed from NCBI nr database AB361036.1-SFBF N/A AB361036.1
mRNA parsed from NCBI nr database AB480705.1-SFBF.m1 N/A AB480705.1
mRNA parsed from NCBI nr database AB480704.1-SFBF.m1 N/A AB480704.1
mRNA parsed from NCBI nr database AB361036.1-SFBF.m1 N/A AB361036.1

Sequence(s):
>AB480705.1-SFBF1140
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttacatagaaagtttgg
ttttactcaatacttattaa
back to top
>AB480704.1-SFBF1140
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttacatagaaagtttgg
ttttactcaatacttattaa
back to top
>AB361036.1-SFBF1140
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttacatagaaagtttgg
ttttactcaatacttattaa
back to top
>AB480705.1-SFBF.m11140
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttacatagaaagtttgg
ttttactcaatacttattaa
back to top
>AB480704.1-SFBF.m11140
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttacatagaaagtttgg
ttttactcaatacttattaa
back to top
>AB361036.1-SFBF.m11140
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttacatagaaagtttgg
ttttactcaatacttattaa
back to top