SFBc, SFBc (gene) Prunus pseudocerasus

Gene Overview
Name SFBc
Gene Symbol SFBc
Type gene
Organism Prunus pseudocerasus
Synonym F-box protein
Description NA
Comment pollen protein that is part of the self-incompatibility system
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus pseudocerasusgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBcEU267943.1-SFBc.m1Prunus pseudocerasusmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU267943.1-SFBc.m1 N/A EU267943.1

Sequence(s):
>EU267943.1-SFBc.m11125
atgacattcaaactaggtaagaaagaaatcttgatcgacatactagcaagactacctgcaaaatccctggttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcaggtccagttttgtgagcacacatattaataggaatgtcagtaaac
atgcccatgtctatctactttgcctccaccacccaacttttgaacgtcaaaatgacaacgatgacccatttgttgaagaa
gaacttcaatggtcacttttttcaaatgaaacatttgagcagttctctaagttaagcaatcccttaggaagcacagaaca
ttatgggatatatggttcaagcaatggtctagtttgcatttcggacgagatattgaattatgatagtcctatacacatat
ggaacccatcggttaggaaatttaggacccctccaatcagccccaacaacattaaatttgtctatgttgctctccaattt
ggcttccactgtggagttaatgactacaaagctgtaagaatgatgcgtaccaacaaagatacctttgcggttgaggttta
tagtcttagaacagactcttggaagatgattgaaacaattcctccttggttaaaatgcacttggcagcatcatacgggta
cattttttaatggagtggcgtaccacatcattgagaaaggtcccttattcagcattatgtctttcgattcaggcagtgaa
gaactcgaagaattcattgcaccagatgccatatgcaattcacgcgggttatgtatcgatgtttacaaggaacaaatttg
tttgctttttacattttatgattgtgaggaggagggcatggagaaaactgacttctgggttctgcaaaaaaaccgatgga
aacaattgtatccttttatttatcctttgatggcttatcgtacaatggggattagtatagatgatgaactcttgatgcaa
agaagagatttcattgagggcggagcagaactgtgcttgtgtaattacgaatccaagcaagttcttgaaacaggaattag
gttggccatcatgccatatgggaaaatcgaattcttgttttcaattacttacatagaaagtttggttttgctcaataact
gttaa
back to top