SFB, SFB (gene) Prunus armeniaca

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus armeniaca
Synonym S-haplotype-specific F-box protein
S haplotype-specific F-box protein
S-locus F-box protein 8
S-locus F-box protein 9
SFB
S-locus F-box protein 13
S-locus SFBc
S14 F-box protein
S14' F-box protein
Description NA
Comment associated with self-incompatibility
GSI
SFB8
SFB9
self-incompatibility SFB8 protein
pollen self-incompatibility protein
truncated form lacking the C-terminus
SFB
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBHQ615603.1-SFBPrunus armeniacagene
SFBJN381951.1-SFBPrunus armeniacagene
SFBJN381950.1-SFBPrunus armeniacagene
SFBJN381949.1-SFBPrunus armeniacagene
SFBJN381948.1-SFBPrunus armeniacagene
SFBJN381947.1-SFBPrunus armeniacagene
SFBJN381946.1-SFBPrunus armeniacagene
SFBJN247798.1-SFBPrunus armeniacagene
SFBJN247797.1-SFBPrunus armeniacagene
SFBJN247796.1-SFBPrunus armeniacagene
SFBJN247795.1-SFBPrunus armeniacagene
SFBJN247794.1-SFBPrunus armeniacagene
SFBJN247793.1-SFBPrunus armeniacagene
SFBEU516388.1-SFBPrunus armeniacagene
SFBEF423613.1-SFBPrunus armeniacagene
SFBEF062342.1-SFBPrunus armeniacagene
SFBDQ422946.1-SFBPrunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBHQ615603.1-SFB.m1Prunus armeniacamRNA
SFBJN381951.1-SFB.m1Prunus armeniacamRNA
SFBJN381950.1-SFB.m1Prunus armeniacamRNA
SFBJN381949.1-SFB.m1Prunus armeniacamRNA
SFBJN381948.1-SFB.m1Prunus armeniacamRNA
SFBJN381947.1-SFB.m1Prunus armeniacamRNA
SFBJN381946.1-SFB.m1Prunus armeniacamRNA
SFBJN247798.1-SFB.m1Prunus armeniacamRNA
SFBJN247797.1-SFB.m1Prunus armeniacamRNA
SFBJN247796.1-SFB.m1Prunus armeniacamRNA
SFBJN247795.1-SFB.m1Prunus armeniacamRNA
SFBJN247794.1-SFB.m1Prunus armeniacamRNA
SFBJN247793.1-SFB.m1Prunus armeniacamRNA
SFBEF053406.1-SFB.m1Prunus armeniacamRNA
SFBEF053404.1-SFB.m1Prunus armeniacamRNA
SFBEF053403.1-SFB.m1Prunus armeniacamRNA
SFBFJ477418.1-SFB.m1Prunus armeniacamRNA
SFBEU516388.1-SFB.m2Prunus armeniacamRNA
SFBEF423613.1-SFB.m1Prunus armeniacamRNA
SFBEF062342.1-SFB.m1Prunus armeniacamRNA
SFBDQ422946.1-SFB.m1Prunus armeniacamRNA
SFBDQ897929.1-SFB.m1Prunus armeniacamRNA
SFBDQ887488.1-SFB.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ615603.1-SFB N/A HQ615603.1
gene parsed from NCBI nr database JN381951.1-SFB N/A JN381951.1
gene parsed from NCBI nr database JN381950.1-SFB scaffold_3:2482814..2483239
JN381950.1
gene parsed from NCBI nr database JN381949.1-SFB N/A JN381949.1
gene parsed from NCBI nr database JN381948.1-SFB N/A JN381948.1
gene parsed from NCBI nr database JN381947.1-SFB N/A JN381947.1
gene parsed from NCBI nr database JN381946.1-SFB N/A JN381946.1
gene parsed from NCBI nr database JN247798.1-SFB N/A JN247798.1
gene parsed from NCBI nr database JN247797.1-SFB N/A JN247797.1
gene parsed from NCBI nr database JN247796.1-SFB N/A JN247796.1
gene parsed from NCBI nr database JN247795.1-SFB N/A JN247795.1
gene parsed from NCBI nr database JN247794.1-SFB N/A JN247794.1
gene parsed from NCBI nr database JN247793.1-SFB N/A JN247793.1
gene parsed from NCBI nr database EU516388.1-SFB N/A EU516388.1
gene parsed from NCBI nr database EF423613.1-SFB N/A EF423613.1
gene parsed from NCBI nr database EF062342.1-SFB N/A EF062342.1
gene parsed from NCBI nr database DQ422946.1-SFB N/A DQ422946.1
mRNA parsed from NCBI nr database HQ615603.1-SFB.m1 N/A HQ615603.1
mRNA parsed from NCBI nr database JN381951.1-SFB.m1 N/A JN381951.1
mRNA parsed from NCBI nr database JN381950.1-SFB.m1 scaffold_3:2482814..2483239
JN381950.1
mRNA parsed from NCBI nr database JN381949.1-SFB.m1 N/A JN381949.1
mRNA parsed from NCBI nr database JN381948.1-SFB.m1 N/A JN381948.1
mRNA parsed from NCBI nr database JN381947.1-SFB.m1 N/A JN381947.1
mRNA parsed from NCBI nr database JN381946.1-SFB.m1 N/A JN381946.1
mRNA parsed from NCBI nr database JN247798.1-SFB.m1 N/A JN247798.1
mRNA parsed from NCBI nr database JN247797.1-SFB.m1 N/A JN247797.1
mRNA parsed from NCBI nr database JN247796.1-SFB.m1 N/A JN247796.1
mRNA parsed from NCBI nr database JN247795.1-SFB.m1 N/A JN247795.1
mRNA parsed from NCBI nr database JN247794.1-SFB.m1 N/A JN247794.1
mRNA parsed from NCBI nr database JN247793.1-SFB.m1 N/A JN247793.1
mRNA parsed from NCBI nr database EF053406.1-SFB.m1 N/A EF053406.1
mRNA parsed from NCBI nr database EF053404.1-SFB.m1 N/A EF053404.1
mRNA parsed from NCBI nr database EF053403.1-SFB.m1 N/A EF053403.1
mRNA parsed from NCBI nr database FJ477418.1-SFB.m1 N/A FJ477418.1
mRNA parsed from NCBI nr database EU516388.1-SFB.m2 N/A EU516388.1
mRNA parsed from NCBI nr database EF423613.1-SFB.m1 N/A EF423613.1
mRNA parsed from NCBI nr database EF062342.1-SFB.m1 N/A EF062342.1
mRNA parsed from NCBI nr database DQ422946.1-SFB.m1 N/A DQ422946.1
mRNA parsed from NCBI nr database DQ897929.1-SFB.m1 N/A DQ897929.1
mRNA parsed from NCBI nr database DQ887488.1-SFB.m1 N/A DQ887488.1

Sequence(s):
>HQ615603.1-SFB1122
atgacattcactctatgtaagaaagaaattttagtcgacatcctggtaagactgcctgcaaaatctctcgttcggtttat
gtgtacatgtaagtcatggagtgatttgattggcagctccagttttgttagcacacaccttaataggaatgtcaataaac
atgcccatgtatatctactttgcctccaccatccaaattttgaatgtgtggtggaccctgatgacccatatttagaagaa
gaagttcaatggtctctttttcccaatgaaacatttgaggaatgctccaagttaaaccatcccttagggagcacagaaca
ttatgggatatatggctccagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacatatat
ggaacccatcagttaggaaacttcggacccttccaataagcaccaacatcattaaatttagccatgttgctctccagttc
gggttccatcccggggttaatgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtgta
tagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaagtgcgcttggcagcattataagggta
catttttcaatggagtagcataccatatcattgaaaaaggtcctatattcagcatcatgtccttcgattcaggcagtgaa
gaatttgaggaattcatagcaccagatgcaatttgccgtccatctgaggtatgtattgacgtttacaaggaccaaatttg
cttgctttttggattttatcgttgtgaggagatgggcatggataaaattgacttgtgggttctgcaagaaaaacggtgga
aacagttgtgtccttttatttatccatggggtttttgttatcgtataaccgggattagtatagataatgaactcttaatg
ggaagaagagatttcttaaagggcgtagcagatctctatttgtgtaagtacgaatccaagcaggttcttgaaacaggaat
taagttgggcatcatgacatatggggaaatcgaattcttgttttcatttacttacatggagagcttggttttactcaatt
aa
back to top
>JN381951.1-SFB434
tgtttatctactttgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaagaatttc
aatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagacatccctcagggagcacagaacattatatg
atatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatatggaaccc
ctcggttaagaaatttaggacccctccaatgagcaccaacattaacattaaatttagctatgttgctctccaattcgggt
tccaccccggggttaacgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagt
ctcaaaacagactcttggaagatgattgaagcaa
back to top
>JN381950.1-SFB434
tgtttatctactttgcctccaccaccaagattttgaacgtaaattcggtgttgacgacccttttgtgaaacaagaccttc
agtggtcacttttttccaacgaaacatttgagcagcgtttcaagttaaagcatcccttagggagcacagagcattttggg
atatacggttcaagcaacggggtactttgcatttcggatgaaatattgaaacccaagagccgtatacacatatggaaccc
aaccattggcaagtataggactgttccgttgagcatcaccgacgacacaaaatttggctacattgctctccaattcgggt
tccaccccggggttaatgactacaaggttgtgaggatgatgtgcatggacaacaaagcattcgccgtcgaggtttttagt
cttgccacaaactcttggaagatgattgaagcaa
back to top
>JN381949.1-SFB660
aatccctggttcggtttctgtgtacgtgcaagtcatggagtgatttgattgggagctcctgttttgtcagcacacacctt
cataggaatgtcacaaaacatacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctga
tgacccatatgttgaacaagaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagacatc
cctcagggagcacagaacattatatgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttc
gatagtccaatacacatatggaacccctcggttaagaaatttaggacccctccaatgagcaccaacattaacattaaatt
tagctatgttgctctccaattcgggttccaccccggggttaacgactacaaggctgtaaggatgatgcgtaccaacaaaa
atgccttggcggttgaggtttatagtctcaaaacagactcttggaagatgattgaagcaattcccccgtggttaaaatgt
acttggcagcatcataagggtacattttttaatggagtagcataccacgtccttctgaaaggtcctatattcagcattat
gtcattcgattcaggcagtg
back to top
>JN381948.1-SFB672
aatccctggttcggtttctgtgtgcatgcaagtcatggagtgatttgattaacagctcgagttttatcaccacacagctt
aacaggaatgtcaccaaacacctccatgtctctctactttgcctccactaccccgatctcaaacgtcctttcgagttcta
cgaaaactacgaggactacccagatcttaaacgagaattggaatggtcacttttctccaacgaaacatttgagcattgct
ccaagttaaaccatcccttggggatcaagaaagattatagggtatatggctcaagcaatggcctagtttgcatttcggat
gacaaattggacaccaagagccctatacacatatggaacccctcggttaggaaatttagaacccttccaatgagcaccaa
cgttaaatttcgctacattgctctccaattcgggttccaccccggggttaacgactacaaggttgtaaggatgttgcgcg
tccacaaagatgatgctttcgcagtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacgtcctctt
tggttaaaatgcacttggcagaaccacaggggtacattttataatggagtaacataccacattattgagaaatttcctct
attcagcgttatgtcattcgattcaggcagtg
back to top
>JN381947.1-SFB660
aatccctggttcggtttctgtgtacatgtaagtcttggagtgatttgattagcagctcgagttttgttagcacacacctt
aacaggaatgtcgcaaaacatgaacatgtctatctcctctgcctccgccacccaaatgttagacgtcaggttgaccgtga
tgacccgtatgttaaaaaagaatttcaatggtctcttttttccaatgaaacatttgaagagtgctccaagttaagccatc
ccttagggagcacagaacattatggaatatatggttcaagcaatggtttagtttgcatttcggatgtgatattgaatttc
gatagtcctatacacatctggaacccatcggtgaggaaatttaggacccctccaatgagcacccacattaacattaaatt
tgcctatgttgctctgcaattcgggttccaccctggggttaatgactacaagactctgaggatgatgcgtaccaacaaag
gtgccgtgggagttgaggtttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgt
acttggcagcatcacaggggtacgttttttaatggagtagcataccacatcattcagaaaggtcctatactcagcattat
gtcattcgattcaggcagtg
back to top
>JN381946.1-SFB660
aatccctggttcggtttctgtgtacatgcaagtcgtggagtgattttattggcagcccgagttttgttagcacacacctt
cataggaatgtcactggacatgcccatgcctatctactttgcctccaccacccaaattttgaatgtcaaagggacgatga
tgacccatatgttaaagaagaactccagtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatc
ctttagaaaatacagagcattataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttc
gatagtcctatacacatatggaacccatcaattagtaaatttaggactcctccaatgagcaccaacataaaccttaaatt
tgcctatgttgctctccaattcgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaag
atgccttggcggttgaggtttatagtcttggaacagactcttggaagatgattgaagtaattcctccttggttaaaatgc
acctggaaacatcataacggtacattttttaatggagtagcatatcacatcattgagaaaggccctatattcagcattat
gtcattcgattcaggcagtg
back to top
>JN247798.1-SFB434
tgtttatctactttgcctccaccacccaaattttgaatgtcaaagggacgatgatgacccatatgttaaagaagaactcc
agtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatcctttagaaaatacagagcattatagg
atatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatatggaaccc
atcaattagtaaatttaggactcctccaatgagcaccaacataaaccttaaatttgcctatgttgctctccaattcgggt
tccacccgggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgccttggcggttgaggtttatagt
cttggaacagactcttggaagatgattgaagcaa
back to top
>JN247797.1-SFB434
tgtttatctactttgcctccaccacccaaattttgaacgtctcgacgaccctgatgacccatatgttgaacaagaattcc
actggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatccctcagggagcacagaacattattgg
atatatggttcaagcaatggtttagtttgcatttcggatgagatactgaacttcgatagtcctatatacatatggaaccc
atcggtcaggaaaagtaggacccctccaatgagctccaacattaacattaaatttagccatgttgctctgcaattcgggt
tccaccccggggttaatgactacaaggttgtaaggatgatgcacaccaacaaaaatgccttagcgattgaggtttatagt
cttagaacagactcttggaagatgattgaagcaa
back to top
>JN247796.1-SFB434
tgtttatctactttgcctccaccacccaaattttgaacgtctcgacgaccctgatgacccatatgttgaacaagaattcc
actggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatccctcagggagcacagaacattattgg
atatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatatacatatggaaccc
atcggtcaggaaaagtaggacccctccaatgagctccaacattaacattaaatttagccatgttgctctgcaattcgggt
tccaccccggggttaatgactacaaggttgtaaggatgatgcacaccaacaaaaatgccttagcgattgaggtttatagt
cttagaacagacccttggaagatgattgaagcaa
back to top
>JN247795.1-SFB660
aatccctggttcggtttctgtgtacatgcaagtcgtggagtgattttattggcagcccgagttttgttagcacacacctt
cataggaatgtcactggacatgcccatgcctatctactttgcctccaccacccaaattttgaatgtcgaagggacgatga
tgacccatatgttaaagaagaactccagtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatc
ctttagaaaatacagagcattataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttc
gatagtcctatacacatatggaacccatcaattagtaaatttaggactcctccaatgagcaccaacataaaccttaaatt
tgcctatgttgctctccaattcgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaag
atgccttggcggttgaggtttatagtcttggaacagactcttggaagatgattgaagtaattcctccttggttaaaatgc
acctggaaacatcataacggtaccttttttaatggagtagcatatcacatcattgagaaaggccctatattcagcattat
gtcattcgattcaggcagtg
back to top
>JN247794.1-SFB434
tgtttatctactttgcctccaccacccaaaatttgaacgcctgatcaaccgtgatgacccatattttgaaaaagaattgc
aatggtctcttttttacaatgaaacatttgagcagtgctacaagctaagccatcccttagggagcacagaacagtattgg
atatatggttcaagcaatggtttaatttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaaccc
atcagttcagagatttaagacccctccaatgagcaccaacattaacattaaatttagccatgttgctctccaattcgggt
tccactccggggttaatgactacaaggttgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggtttatagt
cttggaacagactcttggaagatgattgaagcaa
back to top
>JN247793.1-SFB434
tgtttatctactttgcctccactactcaaattttgaacttcaggctgatcctgatgacccatatgttaaacaagaatttc
aatggtctcttttttccaatcaaacatttgaagagtgctccaagttaagccatcccttagggatcacagaacattacgtg
atgtacggctcaagcaatggtttaatttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaaccc
atcggttaggaaacttagaaccactccaatcagcaccaacattaacattaaatttagccatgttgctctccaattcgggt
tccaccccagggttaatgactacaaggccgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagt
cttagagcagactcttggaagatgattgaagcaa
back to top
>EU516388.1-SFB1051
gtgtacatgcaagtcgtggagtgatttgattggcagctcgggttttgttagtacacaccttcataggaatgtcacaaaac
atgcccatgtctatctactttgcctccaccacccaaactttgaacgtcagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttccaatggaacatttgtgcagttctccaatttaagccatccttcagaaaacacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggtcaggaaatttaggaccactccaacgagcaccaacattaacattaaatttagctatgttgctctccaa
tttggattccaccccggggttgatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaaaatcataagg
atacattttttaatggagtagcatatcacataattgagaaaggtcccatcttcagcattatgtcctttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcggtccatggggtttatgtatcgacatttacaagggacaaat
ttgcttgctttgtagatattatggttgtgaggaggatggcatggaaaaagtcgacttatgggttctgcaagaaaaacggt
ggaagcaattgtgtccttttatttttccttgggatgaatggaacgttacaatcgggattagcatagatgatgaactgtta
atggaaataagagatttcgataagggcgtagcagatctgtatttgtgtaattacgaatccaaggaagttcttaaaacagg
aattaagttggccgtcatgaaatatgacgaaatcgaattcttctttgcaattacttacatacaaagtttggttttactca
ataattattaa
back to top
>EF423613.1-SFB389
cgtgatttgattagcagcccgagttttgtcagcacacacctttataggaatgtcacaaaacatgcccatgtctatctact
ttgccttcaccacccgaattttgaatgtgtggtcgaccctgatgacccatatttggaagaagagcttcaatggtctcttt
tttccaatgaaacatttaagctgtgctccaagttaagccatcccttagggagtacaaatcgttatgggatatatggttca
agcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaacccatcggtaaagaa
atttacgagccctccaatgagcaccaacattaacgtcaaatttacccatgtttctctccaatttgggac
back to top
>EF062342.1-SFB693
aacatcctagtaagactacctgcaaaatcccttgttcggtttctgtgtacgtgcaagtcatggagtgatttgattgggag
ctcctgttttgtcagcacacaccttcataggaatgtcacaaaacatacccatgtctatctactatgcctccaccacccaa
attttgaacgaaacgacgaccctgatgacccatatgttgaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtgctccaagttaagacatccctcagggagcacagaacattatatgatatatggctcaagcaatggcttagtttg
catttcggaggagatattgaatttcgatagtccaatacacatatggaacccctcggttaagaaatttaggacccctccaa
tgagcaccaacattaacattaaatttagctatgttgctctccaattcgggttccaccccggggttaacgactacaaggct
gtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcaaaacagactcttggaagatgattga
agcaattcccccgtggttaaaatgtacttggcagcatcataagggtacattttttaatggagtagcataccacgtccttc
tgaaaggtcctatattcagcattatgtcattcgattcaggcagtgaagaaata
back to top
>DQ422946.1-SFB906
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttattcgctttct
gagtacatgcaagtcgtggagtgatttgattggaagctcaatttttgttagcacacacctttgtaggaatgtgacaaaac
atacccatgtttatctactttgcctccaccacccaaattttgagcgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctctttttcccaaagaaacatttgaggagtgctacaaactaagccatcccttagggatgacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatcctgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttagggcccttccaatgagcaccaacattaacattaaatttagctgtgttgctctccag
ttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaataaaagtgccttggcggttgaggt
ttatagtctcaaaagagactcttggaagatgattgaagcaattcctccttggttaaaatgcactttggaacatcataggg
gtacgtttttcagtggagtagcataccacatcattcagaaaggtcctatgctcagcattatgtcattcgattcaggcagt
gaaaaattcgaagaaatcatagcaccagatgccatttgcagtttatgggggttatatattgacgtttacaaggaacaaat
ttgcttgctttttatatgttatgggtgtgaggaggagggcatggaaaaagctgacttatgggttctgcaagaaaaacggt
ggaaacaattgagtccttttatttag
back to top
>HQ615603.1-SFB.m11122
atgacattcactctatgtaagaaagaaattttagtcgacatcctggtaagactgcctgcaaaatctctcgttcggtttat
gtgtacatgtaagtcatggagtgatttgattggcagctccagttttgttagcacacaccttaataggaatgtcaataaac
atgcccatgtatatctactttgcctccaccatccaaattttgaatgtgtggtggaccctgatgacccatatttagaagaa
gaagttcaatggtctctttttcccaatgaaacatttgaggaatgctccaagttaaaccatcccttagggagcacagaaca
ttatgggatatatggctccagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacatatat
ggaacccatcagttaggaaacttcggacccttccaataagcaccaacatcattaaatttagccatgttgctctccagttc
gggttccatcccggggttaatgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtgta
tagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaagtgcgcttggcagcattataagggta
catttttcaatggagtagcataccatatcattgaaaaaggtcctatattcagcatcatgtccttcgattcaggcagtgaa
gaatttgaggaattcatagcaccagatgcaatttgccgtccatctgaggtatgtattgacgtttacaaggaccaaatttg
cttgctttttggattttatcgttgtgaggagatgggcatggataaaattgacttgtgggttctgcaagaaaaacggtgga
aacagttgtgtccttttatttatccatggggtttttgttatcgtataaccgggattagtatagataatgaactcttaatg
ggaagaagagatttcttaaagggcgtagcagatctctatttgtgtaagtacgaatccaagcaggttcttgaaacaggaat
taagttgggcatcatgacatatggggaaatcgaattcttgttttcatttacttacatggagagcttggttttactcaatt
aa
back to top
>JN381951.1-SFB.m1434
tgtttatctactttgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaagaatttc
aatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagacatccctcagggagcacagaacattatatg
atatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatatggaaccc
ctcggttaagaaatttaggacccctccaatgagcaccaacattaacattaaatttagctatgttgctctccaattcgggt
tccaccccggggttaacgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagt
ctcaaaacagactcttggaagatgattgaagcaa
back to top
>JN381950.1-SFB.m1434
tgtttatctactttgcctccaccaccaagattttgaacgtaaattcggtgttgacgacccttttgtgaaacaagaccttc
agtggtcacttttttccaacgaaacatttgagcagcgtttcaagttaaagcatcccttagggagcacagagcattttggg
atatacggttcaagcaacggggtactttgcatttcggatgaaatattgaaacccaagagccgtatacacatatggaaccc
aaccattggcaagtataggactgttccgttgagcatcaccgacgacacaaaatttggctacattgctctccaattcgggt
tccaccccggggttaatgactacaaggttgtgaggatgatgtgcatggacaacaaagcattcgccgtcgaggtttttagt
cttgccacaaactcttggaagatgattgaagcaa
back to top
>JN381949.1-SFB.m1660
aatccctggttcggtttctgtgtacgtgcaagtcatggagtgatttgattgggagctcctgttttgtcagcacacacctt
cataggaatgtcacaaaacatacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctga
tgacccatatgttgaacaagaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagacatc
cctcagggagcacagaacattatatgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttc
gatagtccaatacacatatggaacccctcggttaagaaatttaggacccctccaatgagcaccaacattaacattaaatt
tagctatgttgctctccaattcgggttccaccccggggttaacgactacaaggctgtaaggatgatgcgtaccaacaaaa
atgccttggcggttgaggtttatagtctcaaaacagactcttggaagatgattgaagcaattcccccgtggttaaaatgt
acttggcagcatcataagggtacattttttaatggagtagcataccacgtccttctgaaaggtcctatattcagcattat
gtcattcgattcaggcagtg
back to top
>JN381948.1-SFB.m1672
aatccctggttcggtttctgtgtgcatgcaagtcatggagtgatttgattaacagctcgagttttatcaccacacagctt
aacaggaatgtcaccaaacacctccatgtctctctactttgcctccactaccccgatctcaaacgtcctttcgagttcta
cgaaaactacgaggactacccagatcttaaacgagaattggaatggtcacttttctccaacgaaacatttgagcattgct
ccaagttaaaccatcccttggggatcaagaaagattatagggtatatggctcaagcaatggcctagtttgcatttcggat
gacaaattggacaccaagagccctatacacatatggaacccctcggttaggaaatttagaacccttccaatgagcaccaa
cgttaaatttcgctacattgctctccaattcgggttccaccccggggttaacgactacaaggttgtaaggatgttgcgcg
tccacaaagatgatgctttcgcagtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacgtcctctt
tggttaaaatgcacttggcagaaccacaggggtacattttataatggagtaacataccacattattgagaaatttcctct
attcagcgttatgtcattcgattcaggcagtg
back to top
>JN381947.1-SFB.m1660
aatccctggttcggtttctgtgtacatgtaagtcttggagtgatttgattagcagctcgagttttgttagcacacacctt
aacaggaatgtcgcaaaacatgaacatgtctatctcctctgcctccgccacccaaatgttagacgtcaggttgaccgtga
tgacccgtatgttaaaaaagaatttcaatggtctcttttttccaatgaaacatttgaagagtgctccaagttaagccatc
ccttagggagcacagaacattatggaatatatggttcaagcaatggtttagtttgcatttcggatgtgatattgaatttc
gatagtcctatacacatctggaacccatcggtgaggaaatttaggacccctccaatgagcacccacattaacattaaatt
tgcctatgttgctctgcaattcgggttccaccctggggttaatgactacaagactctgaggatgatgcgtaccaacaaag
gtgccgtgggagttgaggtttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgt
acttggcagcatcacaggggtacgttttttaatggagtagcataccacatcattcagaaaggtcctatactcagcattat
gtcattcgattcaggcagtg
back to top
>JN381946.1-SFB.m1660
aatccctggttcggtttctgtgtacatgcaagtcgtggagtgattttattggcagcccgagttttgttagcacacacctt
cataggaatgtcactggacatgcccatgcctatctactttgcctccaccacccaaattttgaatgtcaaagggacgatga
tgacccatatgttaaagaagaactccagtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatc
ctttagaaaatacagagcattataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttc
gatagtcctatacacatatggaacccatcaattagtaaatttaggactcctccaatgagcaccaacataaaccttaaatt
tgcctatgttgctctccaattcgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaag
atgccttggcggttgaggtttatagtcttggaacagactcttggaagatgattgaagtaattcctccttggttaaaatgc
acctggaaacatcataacggtacattttttaatggagtagcatatcacatcattgagaaaggccctatattcagcattat
gtcattcgattcaggcagtg
back to top
>JN247798.1-SFB.m1434
tgtttatctactttgcctccaccacccaaattttgaatgtcaaagggacgatgatgacccatatgttaaagaagaactcc
agtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatcctttagaaaatacagagcattatagg
atatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatatggaaccc
atcaattagtaaatttaggactcctccaatgagcaccaacataaaccttaaatttgcctatgttgctctccaattcgggt
tccacccgggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgccttggcggttgaggtttatagt
cttggaacagactcttggaagatgattgaagcaa
back to top
>JN247797.1-SFB.m1434
tgtttatctactttgcctccaccacccaaattttgaacgtctcgacgaccctgatgacccatatgttgaacaagaattcc
actggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatccctcagggagcacagaacattattgg
atatatggttcaagcaatggtttagtttgcatttcggatgagatactgaacttcgatagtcctatatacatatggaaccc
atcggtcaggaaaagtaggacccctccaatgagctccaacattaacattaaatttagccatgttgctctgcaattcgggt
tccaccccggggttaatgactacaaggttgtaaggatgatgcacaccaacaaaaatgccttagcgattgaggtttatagt
cttagaacagactcttggaagatgattgaagcaa
back to top
>JN247796.1-SFB.m1434
tgtttatctactttgcctccaccacccaaattttgaacgtctcgacgaccctgatgacccatatgttgaacaagaattcc
actggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatccctcagggagcacagaacattattgg
atatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatatacatatggaaccc
atcggtcaggaaaagtaggacccctccaatgagctccaacattaacattaaatttagccatgttgctctgcaattcgggt
tccaccccggggttaatgactacaaggttgtaaggatgatgcacaccaacaaaaatgccttagcgattgaggtttatagt
cttagaacagacccttggaagatgattgaagcaa
back to top
>JN247795.1-SFB.m1660
aatccctggttcggtttctgtgtacatgcaagtcgtggagtgattttattggcagcccgagttttgttagcacacacctt
cataggaatgtcactggacatgcccatgcctatctactttgcctccaccacccaaattttgaatgtcgaagggacgatga
tgacccatatgttaaagaagaactccagtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatc
ctttagaaaatacagagcattataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttc
gatagtcctatacacatatggaacccatcaattagtaaatttaggactcctccaatgagcaccaacataaaccttaaatt
tgcctatgttgctctccaattcgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaag
atgccttggcggttgaggtttatagtcttggaacagactcttggaagatgattgaagtaattcctccttggttaaaatgc
acctggaaacatcataacggtaccttttttaatggagtagcatatcacatcattgagaaaggccctatattcagcattat
gtcattcgattcaggcagtg
back to top
>JN247794.1-SFB.m1434
tgtttatctactttgcctccaccacccaaaatttgaacgcctgatcaaccgtgatgacccatattttgaaaaagaattgc
aatggtctcttttttacaatgaaacatttgagcagtgctacaagctaagccatcccttagggagcacagaacagtattgg
atatatggttcaagcaatggtttaatttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaaccc
atcagttcagagatttaagacccctccaatgagcaccaacattaacattaaatttagccatgttgctctccaattcgggt
tccactccggggttaatgactacaaggttgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggtttatagt
cttggaacagactcttggaagatgattgaagcaa
back to top
>JN247793.1-SFB.m1434
tgtttatctactttgcctccactactcaaattttgaacttcaggctgatcctgatgacccatatgttaaacaagaatttc
aatggtctcttttttccaatcaaacatttgaagagtgctccaagttaagccatcccttagggatcacagaacattacgtg
atgtacggctcaagcaatggtttaatttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaaccc
atcggttaggaaacttagaaccactccaatcagcaccaacattaacattaaatttagccatgttgctctccaattcgggt
tccaccccagggttaatgactacaaggccgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagt
cttagagcagactcttggaagatgattgaagcaa
back to top
>EF053406.1-SFB.m11061
ttctcttgttcggtttctgtgtacatgcaagtcgtggagtgatttgattggaagctcaatttttgttagcacacaccttt
gtaggaatgtgacaaaacatacccatgtttatctactttgcctccaccacccaaattttgagcgtttggtcgaccctaat
gacccatatcttaaaaaggaatttcaatggtctctttttcccaaagaaacatttgaggagtgctacaaactaagccatcc
cttagggatgacagaacattatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatcctgaatttcg
atagtcctatacacatatggaacccatcggttaggaaatttagggcccttccaatgagcaccaacattaacattaaattt
agctgtgttgctctccagttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaataaaag
tgccttggcggttgaggtttatagtctcaaaagagactcttggaagatgattgaagcaattcctccttggttaaaatgca
ctttggaacatcataggggtacgtttttcagtggagtagcataccacatcattcagaaaggtcctatgctcagcattatg
tcattcgattcaggcagtgaaaaattcgaagaaatcatagcaccagatgccatttgcagtttatgggggttatatattga
cgtttacaaggaacaaatttgcttgctttttatatgttatgggtgtgaggaggagggcatggaaaaagctgacttatggg
ttctgcaagaaaaacggtggaaacaattgagtccttttatttatcctccggattattattattgtacaacagggattagt
atggataacaaaatcttaatgctaagagtagatgacattagaggcataagaaatctggatttatgtgattacgaatccaa
ccaagttcttgaaacaggaattgagttggccaccatgaaatatggcgaaatcgaattcttgttttcaattacttacgtag
agagtatggttttactcaata
back to top
>EF053404.1-SFB.m11061
ttctcttgttcggtttatttgcacatgcaagtcttggagtgatttgattggcagctcgagttttgttagcacacaccttc
ataggaatgtcacaaaacatgcccatgtctatttactctgcctccgccacccaaatgttgaacgtcaggctgatcctgac
gacccgtatgttgaacaagaatttcaatggtctctattttccaatgaaacatttgaggattgctccaagttaagccatcc
cttggggagcacaaaacattatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatgctgaattttg
atagtcctatacacatatggaacccatcggttaggaaacttagaaccgctccaatcagcagcaacattaacattaaattt
agccatgttgctctccaattcgggttccaccccggggttaatgactacaaggctgtcaggctgatgcgcaccaacaaacg
tgccttggcagttgaggtttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaagtgca
cttggcagcattataagggtacattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcattatg
tcctttgatttaggcagtgaacaattcgaagaattcatagcaccagatgccatttgcagttcatgggggttatgtattga
cgtttacaagggacaaatttgcttgcttttaaaatgttatggttgtgaggaggagggcatggagaaaattgacttatggg
ttctgcaagaaaaactgtggaaacaattgtttccttttatttatccttttggttattgttatgatataatcggtattaat
atagatgatgaactgttaatgggaagaacagatatagctaagggcgtagcagatctatttttgtgtaattacgaatccaa
gcaagttcgtgaaacaggaatcaagttgggcctgatgtcatatggggaaatcgaatccttgtgttcaattacttacatag
aaagtatggttttactcaata
back to top
>EF053403.1-SFB.m11061
ttctcttgttcggtttatttgcacatgcaagtcttggagtgatttgattggcagctcgagttttgttagcacacaccttc
ataggaatgtcacaaaacatgcccatgtctatttactctgcctccaccacccgaatgttgaacgccaggctgatcctgac
gacccgtatgttgaacaagaatttcaatggtctctattttccaatgaaacatttgaggattgctccaagttaagccatcc
cttggggagcacaaaacattatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatgctgaattttg
atagtcctatacacatatggaacccatcggttaggaaacttagaaccgctccaatcagcagcaacattaacattaaattt
agccatgttgctctccaatccgggttccaccccggggttaatgactacaaggctgtcaggctgatgcgcaccaacaaacg
tgccttggcagttgaggtttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaagtgca
cttggcagcattataagggtacattttttaatggagtagcataccacatcgttgagaaaggtcctatattcagcattatg
tcctttgatttaggcagtgaacaattcgaagaattcatagcaccagatgccatttgcagttcatgggggttatgtattga
cgtttacaagggacaaatttgcttgctttcaaaatgttatggttgtgaggaggagggcatggagaaaattgacttatggg
ttctgcaagaaaaactgtggaaacaattgtttccttttatttatccttttggttattgttatgatataatcggtattaat
atagatgatgaactgttaatgggaagaacagatatagctaagggcgtagcagatctatttttgtgtaattacgaatccaa
gcaagttcgtgaaacaggaatcaagttgggcctgatgtcatatggggaaatcgaatccttgtgttcaattacttacatag
aaagcatggttttactcaata
back to top
>FJ477418.1-SFB.m11131
atggcattcacactacgtaagaaagaaatcttaatcgacatcctactaagactacctgcaaaatccctcattcggtttct
aagtacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcacacatcttaataagaatgtcacaaaac
atgcccatgtctatctactttgcctccaccacccaaattttgaatgtgtgatcgaccccgatgacccatatttagaagaa
gaacttcaatggtctctgttttccaatgtaacatttgagaagtgctccaagttaagccatcccctaggaagcacaaaaca
ttatgggatatatggttcaagcaatggtttgctttgcatttctgatgagatattgaatttcgatagtccaatacacatat
ggaacccattggttggaagatataggacccctccaatgagcaccaacattaacattaaatttaattatgttgctctccaa
ttcgggtttcaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcgtggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatatgg
gtacattttttaatggagtagcataccatattattgagaaaggtcccatattcagcattatgtccttcgattcaagcagt
gaagaatttgaagagttcatagcaccagatgccatttgcagttcatggaggttatgcatcagcgtttacaaggaacaact
ttgcttgctttttggattttatggttgtgaggaggaggacatggaaaaacttctcttatgggttctgcaagaaaaacggt
ggaaacaattgtgtcctgttatttatcctgaaggtaattgtcgtcatattctcggaattagtatagataatgaactctta
atgacagaaagaggtttcgataccggcatagcagatctgtatctgcgtaattatgaatccaagcaagttcttgaaacagg
aattaagttggccgtcttgagatatggcgatatcgaattcttgtttgcaatcacttacatagaaagtttggttttactca
acaattgttaa
back to top
>EU516388.1-SFB.m21051
gtgtacatgcaagtcgtggagtgatttgattggcagctcgggttttgttagtacacaccttcataggaatgtcacaaaac
atgcccatgtctatctactttgcctccaccacccaaactttgaacgtcagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttccaatggaacatttgtgcagttctccaatttaagccatccttcagaaaacacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggtcaggaaatttaggaccactccaacgagcaccaacattaacattaaatttagctatgttgctctccaa
tttggattccaccccggggttgatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaaaatcataagg
atacattttttaatggagtagcatatcacataattgagaaaggtcccatcttcagcattatgtcctttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcggtccatggggtttatgtatcgacatttacaagggacaaat
ttgcttgctttgtagatattatggttgtgaggaggatggcatggaaaaagtcgacttatgggttctgcaagaaaaacggt
ggaagcaattgtgtccttttatttttccttgggatgaatggaacgttacaatcgggattagcatagatgatgaactgtta
atggaaataagagatttcgataagggcgtagcagatctgtatttgtgtaattacgaatccaaggaagttcttaaaacagg
aattaagttggccgtcatgaaatatgacgaaatcgaattcttctttgcaattacttacatacaaagtttggttttactca
ataattattaa
back to top
>EF423613.1-SFB.m1389
cgtgatttgattagcagcccgagttttgtcagcacacacctttataggaatgtcacaaaacatgcccatgtctatctact
ttgccttcaccacccgaattttgaatgtgtggtcgaccctgatgacccatatttggaagaagagcttcaatggtctcttt
tttccaatgaaacatttaagctgtgctccaagttaagccatcccttagggagtacaaatcgttatgggatatatggttca
agcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaacccatcggtaaagaa
atttacgagccctccaatgagcaccaacattaacgtcaaatttacccatgtttctctccaatttgggac
back to top
>EF062342.1-SFB.m1693
aacatcctagtaagactacctgcaaaatcccttgttcggtttctgtgtacgtgcaagtcatggagtgatttgattgggag
ctcctgttttgtcagcacacaccttcataggaatgtcacaaaacatacccatgtctatctactatgcctccaccacccaa
attttgaacgaaacgacgaccctgatgacccatatgttgaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtgctccaagttaagacatccctcagggagcacagaacattatatgatatatggctcaagcaatggcttagtttg
catttcggaggagatattgaatttcgatagtccaatacacatatggaacccctcggttaagaaatttaggacccctccaa
tgagcaccaacattaacattaaatttagctatgttgctctccaattcgggttccaccccggggttaacgactacaaggct
gtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcaaaacagactcttggaagatgattga
agcaattcccccgtggttaaaatgtacttggcagcatcataagggtacattttttaatggagtagcataccacgtccttc
tgaaaggtcctatattcagcattatgtcattcgattcaggcagtgaagaaata
back to top
>DQ422946.1-SFB.m1906
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttattcgctttct
gagtacatgcaagtcgtggagtgatttgattggaagctcaatttttgttagcacacacctttgtaggaatgtgacaaaac
atacccatgtttatctactttgcctccaccacccaaattttgagcgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctctttttcccaaagaaacatttgaggagtgctacaaactaagccatcccttagggatgacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatcctgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttagggcccttccaatgagcaccaacattaacattaaatttagctgtgttgctctccag
ttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaataaaagtgccttggcggttgaggt
ttatagtctcaaaagagactcttggaagatgattgaagcaattcctccttggttaaaatgcactttggaacatcataggg
gtacgtttttcagtggagtagcataccacatcattcagaaaggtcctatgctcagcattatgtcattcgattcaggcagt
gaaaaattcgaagaaatcatagcaccagatgccatttgcagtttatgggggttatatattgacgtttacaaggaacaaat
ttgcttgctttttatatgttatgggtgtgaggaggagggcatggaaaaagctgacttatgggttctgcaagaaaaacggt
ggaaacaattgagtccttttatttag
back to top
>DQ897929.1-SFB.m11123
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttattcgctttct
gagtacatgcaagtcgtggagtgatttgattggaagctcaatttttgttagcacacacctttgtaggaatgtgacaaaac
atacccatgtttatctactttgcctccaccacccaaattttgagcgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctctttttcccaaagaaacatttgaggagtgctacaaactaagccatcccttagggatgacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatcctgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttagggcccttccaatgagcaccaacattaacattaaatttagctgtgttgctctccag
ttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaataaaagtgccttggcggttgaggt
ttatagtctcaaaagagactcttggaagatgattgaagcaattcctccttggttaaaatgcactttggaacatcataggg
gtacgtttttcagtggagtagcataccacatcattcagaaaggtcctatgctcagcattatgtcattcgattcaggcagt
gaaaaattcgaagaaatcatagcaccagatgccatttgcagtttatgggggttatatattgacgtttacaaggaacaaat
ttgcttgctttttatatgttatgggtgtgaggaggagggcatggaaaaagctgacttatgggttctgcaagaaaaacggt
ggaaacaattgagtccttttatttatcctccggattattattattgtacaacagggattagtatggataacaaaatctta
atgctaagagtagatgacattagaggcataagaaatctggatttatgtgattacgaatccaaccaagttcttgaaacagg
aattgagttggccaccatgaaatatggcgaaatcgaattcttgttttcaattacttacgtagaaactttacctttactca
att
back to top
>DQ887488.1-SFB.m1906
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttattcgctttct
gagtacatgcaagtcgtggagtgatttgattggaagctcaatttttgttagcacacacctttgtaggaatgtgacaaaac
atacccatgtttatctactttgcctccaccacccaaattttgagcgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctctttttcccaaagaaacatttgaggagtgctacaaactaagccatcccttagggatgacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatcctgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttagggcccttccaatgagcaccaacattaacattaaatttagctgtgttgctctccag
ttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaataaaagtgccttggcggttgaggt
ttatagtctcaaaagagactcttggaagatgattgaagcaattcctccttggttaaaatgcactttggaacatcataggg
gtacgtttttcagtggagtagcataccacatcattcagaaaggtcctatgctcagcattatgtcattcgattcaggcagt
gaaaaattcgaagaaatcatagcaccagatgccatttgcagtttatgggggttatatattgacgtttacaaggaacaaat
ttgcttgctttttatatgttatgggtgtgaggaggagggcatggaaaaagctgacttatgggttctgcaagaaaaacggt
ggaaacaattgagtccttttatttag
back to top