SFB, SFB (gene) Prunus avium

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus avium
Synonym SFB6
SFB3
S-locus F-box protein
S haplotype-specific F-box protein 7
truncated S-locus F-box protein
S haplotype-specific F-box protein 13
Description NA
Comment PaSFB3
PaSFB16
PaSFB13
PaSFB12
PaSFB10
PaSFB7
PaSFB6
PaSFB2
PaSFB5
PaSFB1
SFB7
natural pollen mutant; self-compatible
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAY571666.1-SFBPrunus aviumgene
SFBAY571665.1-SFBPrunus aviumgene
SFBAY805057.1-SFBPrunus aviumgene
SFBAY805056.1-SFBPrunus aviumgene
SFBAY805055.1-SFBPrunus aviumgene
SFBAY805054.1-SFBPrunus aviumgene
SFBAY805053.1-SFBPrunus aviumgene
SFBAY805052.1-SFBPrunus aviumgene
SFBAY805051.1-SFBPrunus aviumgene
SFBAY805049.1-SFBPrunus aviumgene
SFBEU035976.1-SFBPrunus aviumgene
SFBEU077238.1-SFBPrunus aviumgene
SFBEU077237.1-SFBPrunus aviumgene
SFBDQ385844.1-SFBPrunus aviumgene
SFBAY805050.1-SFBPrunus aviumgene
SFBAY805048.1-SFBPrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAY571666.1-SFB.m1Prunus aviummRNA
SFBAY571665.1-SFB.m1Prunus aviummRNA
SFBAY805057.1-SFB.m1Prunus aviummRNA
SFBAY805056.1-SFB.m1Prunus aviummRNA
SFBAY805055.1-SFB.m1Prunus aviummRNA
SFBAY805054.1-SFB.m1Prunus aviummRNA
SFBAY805053.1-SFB.m1Prunus aviummRNA
SFBAY805052.1-SFB.m1Prunus aviummRNA
SFBAY805051.1-SFB.m1Prunus aviummRNA
SFBAY805049.1-SFB.m1Prunus aviummRNA
SFBEU035976.1-SFB.m1Prunus aviummRNA
SFBEU077238.1-SFB.m1Prunus aviummRNA
SFBEU077237.1-SFB.m1Prunus aviummRNA
SFBDQ385844.1-SFB.m1Prunus aviummRNA
SFBAY805050.1-SFB.m1Prunus aviummRNA
SFBAY805048.1-SFB.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY571666.1-SFB N/A AY571666.1
gene parsed from NCBI nr database AY571665.1-SFB N/A AY571665.1
gene parsed from NCBI nr database AY805057.1-SFB N/A AY805057.1
gene parsed from NCBI nr database AY805056.1-SFB N/A AY805056.1
gene parsed from NCBI nr database AY805055.1-SFB N/A AY805055.1
gene parsed from NCBI nr database AY805054.1-SFB N/A AY805054.1
gene parsed from NCBI nr database AY805053.1-SFB N/A AY805053.1
gene parsed from NCBI nr database AY805052.1-SFB N/A AY805052.1
gene parsed from NCBI nr database AY805051.1-SFB N/A AY805051.1
gene parsed from NCBI nr database AY805049.1-SFB N/A AY805049.1
gene parsed from NCBI nr database EU035976.1-SFB N/A EU035976.1
gene parsed from NCBI nr database EU077238.1-SFB N/A EU077238.1
gene parsed from NCBI nr database EU077237.1-SFB N/A EU077237.1
gene parsed from NCBI nr database DQ385844.1-SFB N/A DQ385844.1
gene parsed from NCBI nr database AY805050.1-SFB N/A AY805050.1
gene parsed from NCBI nr database AY805048.1-SFB N/A AY805048.1
mRNA parsed from NCBI nr database AY571666.1-SFB.m1 N/A AY571666.1
mRNA parsed from NCBI nr database AY571665.1-SFB.m1 N/A AY571665.1
mRNA parsed from NCBI nr database AY805057.1-SFB.m1 N/A AY805057.1
mRNA parsed from NCBI nr database AY805056.1-SFB.m1 N/A AY805056.1
mRNA parsed from NCBI nr database AY805055.1-SFB.m1 N/A AY805055.1
mRNA parsed from NCBI nr database AY805054.1-SFB.m1 N/A AY805054.1
mRNA parsed from NCBI nr database AY805053.1-SFB.m1 N/A AY805053.1
mRNA parsed from NCBI nr database AY805052.1-SFB.m1 N/A AY805052.1
mRNA parsed from NCBI nr database AY805051.1-SFB.m1 N/A AY805051.1
mRNA parsed from NCBI nr database AY805049.1-SFB.m1 N/A AY805049.1
mRNA parsed from NCBI nr database EU035976.1-SFB.m1 N/A EU035976.1
mRNA parsed from NCBI nr database EU077238.1-SFB.m1 N/A EU077238.1
mRNA parsed from NCBI nr database EU077237.1-SFB.m1 N/A EU077237.1
mRNA parsed from NCBI nr database DQ385844.1-SFB.m1 N/A DQ385844.1
mRNA parsed from NCBI nr database AY805050.1-SFB.m1 N/A AY805050.1
mRNA parsed from NCBI nr database AY805048.1-SFB.m1 N/A AY805048.1

Sequence(s):
>AY571666.1-SFB992
accttcataggaatgccacaaaacatacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgac
cctgatgacccatatgttgaacaagaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaag
ccatccctcagggagcacaaaacattatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattga
atttcgatagtccaatacacatatggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacatt
aaatttagccatgttgctctccaattcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaa
caaaaatgccttggcagttgaggtttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaa
aatgcacttggcagcatcataagggtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagc
attatgtcattcgattcaggcagtgatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatg
tattgacatttacaaggaacgagtttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgact
tatgggttctgcaagaaaaacgatggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggata
actatagataataaactcttaatggtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtc
caagcaagtttttgaaacaggaattgagttggccgtcatgaaatatggtgaaatcgaattattgtttgcaattacttaca
tagaaagtttggctttacttaataaatattga
back to top
>AY571665.1-SFB1131
atgacattcacattacgtaagaacgagatcttaatcgacatcctagtaagactacctgcaaaatccctcattcggtttct
atgtacatgcaagtcgtggagtgatttgattggcagctcaagttttgttcgcacacaccttcataggaatgtcacaaaac
atgctcatgtctatctactttgccttcaccacccacaatttgaacgtcagaacgacaatgatgacccatatgatatagaa
gaacttcagtggtcacttttttccaatgaaaagtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttttagaatatatggttcaagcaatggtttagtttgcatgtcggatgagatattgaatttcgatagtcctatacaaatat
ggaacccatcggttaggaaattcaggactcttccaatgagcaccaacattaacatgaaattttcccatgtttctctccaa
tttgggttccaccccggggttaatgactacaaggctgtaaggatgatgcataccaacaaaggtgccttggcagttgaggt
ttatagtcttaaaacagattgttggaagatgattgaagtaattcctccttggttaaaatgcacttggaagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagc
gaaaaattcgaagaattcataacaccagatgccatttgcagtccacgggagttatgcattgacgtctacaaggaactaat
ttgcttgatttttggattttatggttgtgatgaggagggcatggacaaagttgacttgtgggttctgcaggaaaaacggt
ggaaacaattgtgtccttttatttttcctttgaatcattgtcatcgtacaatcgggattagtatagataatgaactcata
atgcaaagaagagatttcattaaaggagtagcatatctgtatttgtgtaattacgaatccaagcaagttcttgaaacagg
aattcaattggccgtcatgagatatggcgaaatcgaattcttgtttgcaattacttacacagaaagtttggttttgctca
ataattattaa
back to top
>AY805057.1-SFB1099
atgacattcacattacgtaagaacgagatcttaatcgacatcctagtaagactacctgcaaaatccctcattcggtttct
atgtacatgcaagtcgtggagtgatttgattggcagctcaagttttgttcgcacacaccttcataggaatgtcacaaaac
atgctcatgtctatctactttgccttcaccacccacaatttgaacgtcagaacgacaatgatgacccatatgatatagaa
gaacttcagtggtcacttttttccaatgaaaagtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttttagaatatatggttcaagcaatggtttagtttgcatgtcggatgagatattgaatttcgatagtcctatacaaatat
ggaacccatcggttaggaaattcaggactcttccaatgagcaccaacattaacatgaaattttcccatgtttctctccaa
tttgggttccaccccggggttaatgactacaaggctgtaaggatgatgcataccaacaaaggtgccttggcagttgaggt
ttatagtcttaaaacagattgttggaagatgattgaagtaattcctccttggttaaaatgcacttggaagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagc
gaaaaattcgaagaattcataacaccagatgccatttgcagtccacgggagttatgcattgacgtctacaaggaactaat
ttgcttgatttttggattttatggttgtgatgaggagggcatggacaaagttgacttgtgggttctgcaggaaaaacggt
ggaaacaattgtgtccttttatttttcctttgaatcattgtcatcgtacaatcgggattagtatagataatgaactcata
atgcaaagaagagatttcattaaaggagtagcatatctgtatttgtgtaattacgaatccaagcaagttcttgaaacagg
aattcaattggccgtcatgagatatggcgaaatcgaattcttgtttgcaattacttacg
back to top
>AY805056.1-SFB1120
atggcattcacactgcgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgaattgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaacgaaacgaggaccccgatgacccatatgttgaacaa
gaatttcagtggtcccttttttctaatgagacatttgaggagtgctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacattt
ggaacccatcggttaagaaagttaggacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggtttcacccgggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttagtggttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagccattcctccttggataaaatgcccttggcagcattataagg
gtacattttttaatggagtagcataccatatccttcagaaaggtcctatattcagcattatgtcatttgattcaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcagtccatctgaattatgtatggacgtttacaaggaacaaat
ttgcttgctttttagcttttattcttgtgaggaagagggcatgacaaaaaaggacttatgggttatgcaagaaaaacggt
ggaaacaattgtgtccttttatccatccttttgattgtgatggtacaatcgggattagtatagataatgaactcctaata
gaaagaagagatttcgataggggtgtagcagttctgaatttgtgtaattacgaatccaagcaagctcttgaaacaggaat
tgagttggcagtcatcaaatatggcgaaatcgaattcttctttgtaatgacttatatagaaactttaccttttctcaatt
back to top
>AY805055.1-SFB1099
atgagatttacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggaagcttgagttttgtgagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatctactttgcctccactactcaaattttgaacttcaggctgatcccgatgacccacatgttaaacaa
gaatttcaatggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatcccttagggatcacagaaca
ttatgtgatgtatggctcaagcaatggattaatttgcatttcggatgagatactgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccaccccaatcagcaccaacattaacattaaatttagccacgttgctctccaa
ttcggattccaccccggagttaatgactgcaaggctgtaaggatgatgcgtaccaacaaaaataccttagcggttgaggt
ttatagtcttaaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaagg
gtacaatttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcttttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcagttcatgggggttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttaagttttattcttgtgaggtggaaggcatgaagaaaatcgacttatgggctctgcaagaaaaacggt
ggaaacaattgtgtccttttactttttctttggattacaattatcgtacaatcgggattagtgtagataataaactctta
atgctaagaacagattacaataggggcatatcaaatctgcatttgtatgattacgatttcaagcaagttcttgatacagg
aattaagttggccgtcatgaaatatggcgaaatcgaattcttgtattcaactgcttatg
back to top
>AY805054.1-SFB1093
atgccattttcatgtaagaaagaaatcttaactgacatcctggtaagactacctgcaaaatcactcgttcgatttctgtg
tacatccaagttatggagtgatttgattggcagctcgagctttgctagcatgcaccttcataggaatgtcgcaaaacatg
cccatgtctatctcctctgcctccaccacccaaatgttagacgtcaggtccaccctgatgacccatatgttcaacaagaa
tttcaatggtctcttttttccaatgaaacatctgagaagtgtttcaagttatgccatcccctagggagcacagaatattt
tgtgatatatggttcaagcaacggtttagtttgcgtttcggatgagatattgaatttcgatagtcctatacacatatgga
acccatcggttaggaaatttaggaccattccaatgagcaccaatactaacatcaaatttgcctatcttgctctccacttc
gggttccaccctgggattaatgactacaaggcggtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggttta
tagtcttagaacagactcttggaagatgattgaagctattcctccatggttaaaatgcacttggcagcatcataagggta
cattctttgatggggtatcatatcacatcattgagaaaggtcctatattcagtattgtgtcctttgattcaagcagcgaa
gtattcgaagaattcatagcaccagatgccatttgccgtccatttgctttatgtattgatgttttcaaggagcaaatttg
cttgctttttagatattattcttgtgcggaggaggacatggcaaaaaatgacttatgggttctggaagaaaaacggtgga
aacaaatgtgtccttttatttatcctcttgatagttatggtacaatcgggattagtatgggtaatgaactcttaatggaa
agaagagatttcattaagggcgtaggagatctgtgtttgtgtaattacgaatccaagcaagttcttgaaacaggaattga
gttggccgtaacgaaatatggcgaaatggaattcttgtttgcaatgacttaca
back to top
>AY805053.1-SFB1099
atggcattcacactacgtaagaaagaaatcttgatcgacatcctacaaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggactgatttgattggaagctcgaggtttgttagcacacaccttcacaggaatgtcacaaagc
atgcccatgtctatctactctgcctccaccacccaaattttgaacgaaacgaggaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaatttaagccatcccttagggagcacagaaca
ttatgtgatatatggctcaagcaatagtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccactccaatcagcaccaatattaacattaaatttagccatatggctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaattccttcgcagttgaggt
ttatagtcttaaaacagactgctggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaagg
gtacattgtataatggagtagcataccacataattcagaaaggccctatattcagcattatgtcgtttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccctttgcagttcatgggggttatgcattgacgtttacaaggaacaaat
ttgcttgcttcttaagttttattcttgtgagttggaaggcatgaagaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgagtcctttcattttttctttggattacaattatcgtacaatcgggattagtatagataatagactctta
atgctaagaacagattacaataggggcatatcaaatttgcatttgtatgattacgatttcaagcaagttcttgatacggg
aattaagttggccgtcatgaaatatggcgaaatcgaattcttgtattcaacttcttaca
back to top
>AY805052.1-SFB1099
atgacattcacactacgtgagaaagaaattttaatcaacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcaagttttgtcagcacacaccttcataggaatgtcacaaaac
atgcccatgtctgtctactctgcctccaccacccaaatgttagacgccagttcaaccctgatgacccatatgttaaacaa
gaatgccaatggtctcttttttccattgaaacatttgaggagcgctccaagttaacccatcccttaaggagcacagaaca
ttatgggatatatggttcaagcaatggtttaatttgcatttcggatgagatattgaatttcgatagtcctatatacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacattaaatttagctatgttgatctccaa
ttcgggttccacccccggtttaatgactacaaggctgtaaggatgatgcgtacgaacaaaaatgctttcacagttgaggt
ttatagtcttagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcaatccaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcgctccatggggattatgtattgacgtctacaagggacaaat
ttgcttgctttttatgtgctttggttgtgaggaggagggcatggacaaagttgacttatgggttctgcaaggaaaacgat
ggaaacaattgtgtccttttgtttttcctttcggttattgtgatcttttactcgggattagtatagataatgaactcata
atgggaacaaaagatttcgataagggcgtaggaaatctgtatttgtgtagttacgaatccaagcacgttcttgaaacagg
aattaagttggggatcatgacatatggggaaatcgaattcttgttttcaattacttaca
back to top
>AY805051.1-SFB1096
atgacattcacactacgtaagaaagatatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggattgatttgattggcagctccagttttatcagcacacaccttcataggaatgccacaaaac
atacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaaca
ttatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatat
ggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacattaaatttagccatgttgctctccaa
ttcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagt
gatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatgtattgacatttacaaggaacgagt
ttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgat
ggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggataactatagataataaactcttaatg
gtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtccaagcaagtttttgaaacaggaat
tgagttggccgtcatgaaatatggtgaaatcgaattattgtttgcaattacttatg
back to top
>AY805049.1-SFB1102
atgatattcgcactacgtaagaaagaaaccttaatcgacattctagtaagactgccttcaaaatccctcgttcgatttct
ctttacatgcaaatcgtggagtgatttgatttgcagctcgagttttgttagcacacaacttcataggaatgtcacaaaac
atgcccaaatctatctgctttgtctccaccacccaaattttgaacggaacgacgacccagatgacccatatgttaagcaa
gaatttcactggtctcttttttcaaatgaaacatttgaggagtgctccaagttaagccatcccctagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctttacacatat
ggaacccatcggtcaggaaacttaggacccctccaatcagcaccaacattagcatcaaatttagccatgttgctctgcaa
tttgggttccaccctgaggttaatgactacaaggttgtaaggatgatgcgcaccaacaaaaatgccttggcggttgaggt
ttatagtcttagaagagaccgttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattcagaaaggtcctctattcagcattatgtccttcgattcaggcagt
gaagtttttgaagaattcatagcaccagatgctatttgcaatttatggggtttatgtatccaggtttacaaggaacaaat
ttgcttgctttctggattttatggttgtgaggaggagggcatggaaaaaattgacttctgggttctgcaagaaaaccggt
ggaaacaattgtgtccttttatttatgatcctttggattattgtcatcgtataatcgggattagtatagataatgaactc
ttgatggaaagagaagatttccttcggggcgtagggtatctgcatttgtgtaattacgaatccaagcaagttcttgaaac
aggaattgagttggctgttatgaaatatggcgaaatcgaattctcgtatgcaattacttata
back to top
>EU035976.1-SFB1125
atgacattcacactacgtgagaaagaaattttaatcaacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcaagttttgtcagcacacaccttcataggaatgtcacaaaac
atgcccatgtctgtctactctgcctccaccacccaaatgttagacgccagttcaaccctgatgacccatatgttaaacaa
gaatgccaatggtctcttttttccattgaaacatttgaggagcgctccaagttaacccatcccttaaggagcacagaaca
ttatgggatatatggttcaagcaatggtttaatttgcatttcggatgagatattgaatttcgatagtcctatatacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacattaaatttagctatgttgatctccaa
ttcgggttccacccccggtttaatgactacaaggctgtaaggatgatgcgtacgaacaaaaatgctttcacagttgaggt
ttatagtcttagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcaatccaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcgctccatggggattatgtattgacgtctacaagggacaaat
ttgcttgctttttatgtgctttggttgtgaggaggagggcatggacaaagttgacttatgggttctgcaaggaaaacgat
ggaaacaattgtgtccttttgtttttcctttcggttattgtgatcttttactcgggattagtatagataatgaactcata
atgggaacaaaagatttcgataagggcgtaggaaatctgtatttgtgtagttacgaatccaagcacgttcttgaaacagg
aattaagttggggatcatgacatatggggaaatcgaattcttgttttcaattacttacacagaaagtttggttttactca
attaa
back to top
>EU077238.1-SFB1085
atgacattcacactacgtaagaaagatatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggattgatttgattggcagctccagttttatcagcacacaccttcataggaatgccacaaaac
atacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaaca
ttatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatat
ggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacattaaatttagccatgttgctctccaa
ttcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagt
gatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatgtattgacatttacaaggaacgagt
ttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgat
ggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggataactatagataataaactcttaatg
gtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtccaagcaagtttttgaaacaggaat
tgagttggccgtcatgaaatatggtgaaatcgaattattgtttgc
back to top
>EU077237.1-SFB861
atgatattctcactgcgtaaggaagaaatcttaatagacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggagtgatttggttggcagctcgagttttgtcagcacacaccttcataggaatatcacaaaac
atgcccatgtccatctactctgcctccaccacccaaatgttagacgtcaggtcaatcctgatgacccatatgttacacaa
gaatttcaatggtctctctttcccaatgaaacatttgaggagtgttccaaattaagccatcctttagggagcacagaaca
ttatgggatatatggttcaagtaatggtttagtttgcatctcggatgagatattgaatttcgatagtcctatactcatgt
ggaacccatcagttaggaaatttaggaccgctccaacgagcaccaacattaaccttaagtttgcctatgttgctctccaa
ttcggcttccaccatgcggttaatgactacaaggttgtaaggatgatgcgcaccaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatagag
gtacgttttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgcggtttgcagttcttggggtttatgtattgacgtttacaatgaccaaat
ttgcttgctttctggattttatggttgtgaggatgagggcttggacaaaattgacttatag
back to top
>DQ385844.1-SFB1131
atgagatttacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggaagcttgagttttgtgagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatctactttgcctccactactcaaattttgaacttcaggctgatcccgatgacccacatgttaaacaa
gaatttcaatggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatcccttagggatcacagaaca
ttatgtgatgtatggctcaagcaatggattaatttgcatttcggatgagatactgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccaccccaatcagcaccaacattaacattaaatttagccacgttgctctccaa
ttcggattccaccccggagttaatgactgcaaggctgtaaggatgatgcgtaccaacaaaaataccttagcggttgaggt
ttatagtcttaaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaagg
gtacaatttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcttttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcagttcatgggggttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttaagttttattcttgtgaggtggaaggcatgaagaaaatcgacttatgggctctgcaagaaaaacggt
ggaaacaattgtgtccttttactttttctttggattacaattatcgtacaatcgggattagtgtagataataaactctta
atgctaagaacagattacaataggggcatatcaaatctgcatttgtatgattacgatttcaagcaagttcttgatacagg
aattaagttggccgtcatgaaatatggcgaaatcgaattcttgtattcaactgcttacatagaaagtttggttttactca
ataattattaa
back to top
>AY805050.1-SFB1102
atgacattctcactgcgtaaggaagaaatcttaatagacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggagtgatttggttggcagctcgagttttgtcagcacacaccttcataggaatatcacaaaac
atgcccatgtccatctactctgcctccaccacccaaatgttagacgtcaggtcaatcctgatgacccatatgttacacaa
gaatttcaatggtctctctttcccaatgaaacatttgaggagtgttccaagttaagccatcctttagggagcacagaaca
ttatgggatatatggttcaagtaatggtttagtttgcatctcggatgagatattgaatttcgatagtcctatactcatgt
ggaacccatcagttaggaaatttaggaccgctccaacgagcaccaacattaaccttaagtttgcctatgttgctctccaa
ttcggcttccaccatgcggttaatgactacaaggttgtaaggatgatgcgcaccaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcacagag
gtacgttttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgcggtttgcagttcttggggtttatgtattgacgtttacaatgaccaaat
ttgcttgctttctggattttatggttgtgaggatgagggcttggacaaaattgacttatgggttttgcaagaaaaacagt
ggaaagaattgtgtcctgttatttttcctcctttgggtgattgtgatcgtataatcgggattagtataggtattgaactc
ttaatggaaaaaaaagatttcgataagggcgtaggagagctgtatttgtgtaattacgaatccaagcaagttcttcaaac
aggtattaagttggcggtcatgaaatatgacgaaatcgaattcgtgtttgcaattacttaca
back to top
>AY805048.1-SFB1099
atggcatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccgtggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagc
gaagaatttgaagagttcatagcaccagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggt
ggaaacaattgtgcccttttatttattcttcagattattgttatcgtacaatcgggattagtatagataatgaactctta
acggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttacg
back to top
>AY571666.1-SFB.m1992
accttcataggaatgccacaaaacatacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgac
cctgatgacccatatgttgaacaagaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaag
ccatccctcagggagcacaaaacattatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattga
atttcgatagtccaatacacatatggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacatt
aaatttagccatgttgctctccaattcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaa
caaaaatgccttggcagttgaggtttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaa
aatgcacttggcagcatcataagggtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagc
attatgtcattcgattcaggcagtgatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatg
tattgacatttacaaggaacgagtttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgact
tatgggttctgcaagaaaaacgatggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggata
actatagataataaactcttaatggtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtc
caagcaagtttttgaaacaggaattgagttggccgtcatgaaatatggtgaaatcgaattattgtttgcaattacttaca
tagaaagtttggctttacttaataaatattga
back to top
>AY571665.1-SFB.m11131
atgacattcacattacgtaagaacgagatcttaatcgacatcctagtaagactacctgcaaaatccctcattcggtttct
atgtacatgcaagtcgtggagtgatttgattggcagctcaagttttgttcgcacacaccttcataggaatgtcacaaaac
atgctcatgtctatctactttgccttcaccacccacaatttgaacgtcagaacgacaatgatgacccatatgatatagaa
gaacttcagtggtcacttttttccaatgaaaagtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttttagaatatatggttcaagcaatggtttagtttgcatgtcggatgagatattgaatttcgatagtcctatacaaatat
ggaacccatcggttaggaaattcaggactcttccaatgagcaccaacattaacatgaaattttcccatgtttctctccaa
tttgggttccaccccggggttaatgactacaaggctgtaaggatgatgcataccaacaaaggtgccttggcagttgaggt
ttatagtcttaaaacagattgttggaagatgattgaagtaattcctccttggttaaaatgcacttggaagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagc
gaaaaattcgaagaattcataacaccagatgccatttgcagtccacgggagttatgcattgacgtctacaaggaactaat
ttgcttgatttttggattttatggttgtgatgaggagggcatggacaaagttgacttgtgggttctgcaggaaaaacggt
ggaaacaattgtgtccttttatttttcctttgaatcattgtcatcgtacaatcgggattagtatagataatgaactcata
atgcaaagaagagatttcattaaaggagtagcatatctgtatttgtgtaattacgaatccaagcaagttcttgaaacagg
aattcaattggccgtcatgagatatggcgaaatcgaattcttgtttgcaattacttacacagaaagtttggttttgctca
ataattattaa
back to top
>AY805057.1-SFB.m11099
atgacattcacattacgtaagaacgagatcttaatcgacatcctagtaagactacctgcaaaatccctcattcggtttct
atgtacatgcaagtcgtggagtgatttgattggcagctcaagttttgttcgcacacaccttcataggaatgtcacaaaac
atgctcatgtctatctactttgccttcaccacccacaatttgaacgtcagaacgacaatgatgacccatatgatatagaa
gaacttcagtggtcacttttttccaatgaaaagtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttttagaatatatggttcaagcaatggtttagtttgcatgtcggatgagatattgaatttcgatagtcctatacaaatat
ggaacccatcggttaggaaattcaggactcttccaatgagcaccaacattaacatgaaattttcccatgtttctctccaa
tttgggttccaccccggggttaatgactacaaggctgtaaggatgatgcataccaacaaaggtgccttggcagttgaggt
ttatagtcttaaaacagattgttggaagatgattgaagtaattcctccttggttaaaatgcacttggaagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagc
gaaaaattcgaagaattcataacaccagatgccatttgcagtccacgggagttatgcattgacgtctacaaggaactaat
ttgcttgatttttggattttatggttgtgatgaggagggcatggacaaagttgacttgtgggttctgcaggaaaaacggt
ggaaacaattgtgtccttttatttttcctttgaatcattgtcatcgtacaatcgggattagtatagataatgaactcata
atgcaaagaagagatttcattaaaggagtagcatatctgtatttgtgtaattacgaatccaagcaagttcttgaaacagg
aattcaattggccgtcatgagatatggcgaaatcgaattcttgtttgcaattacttacg
back to top
>AY805056.1-SFB.m11120
atggcattcacactgcgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgaattgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaacgaaacgaggaccccgatgacccatatgttgaacaa
gaatttcagtggtcccttttttctaatgagacatttgaggagtgctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacattt
ggaacccatcggttaagaaagttaggacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggtttcacccgggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttagtggttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagccattcctccttggataaaatgcccttggcagcattataagg
gtacattttttaatggagtagcataccatatccttcagaaaggtcctatattcagcattatgtcatttgattcaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcagtccatctgaattatgtatggacgtttacaaggaacaaat
ttgcttgctttttagcttttattcttgtgaggaagagggcatgacaaaaaaggacttatgggttatgcaagaaaaacggt
ggaaacaattgtgtccttttatccatccttttgattgtgatggtacaatcgggattagtatagataatgaactcctaata
gaaagaagagatttcgataggggtgtagcagttctgaatttgtgtaattacgaatccaagcaagctcttgaaacaggaat
tgagttggcagtcatcaaatatggcgaaatcgaattcttctttgtaatgacttatatagaaactttaccttttctcaatt
back to top
>AY805055.1-SFB.m11099
atgagatttacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggaagcttgagttttgtgagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatctactttgcctccactactcaaattttgaacttcaggctgatcccgatgacccacatgttaaacaa
gaatttcaatggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatcccttagggatcacagaaca
ttatgtgatgtatggctcaagcaatggattaatttgcatttcggatgagatactgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccaccccaatcagcaccaacattaacattaaatttagccacgttgctctccaa
ttcggattccaccccggagttaatgactgcaaggctgtaaggatgatgcgtaccaacaaaaataccttagcggttgaggt
ttatagtcttaaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaagg
gtacaatttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcttttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcagttcatgggggttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttaagttttattcttgtgaggtggaaggcatgaagaaaatcgacttatgggctctgcaagaaaaacggt
ggaaacaattgtgtccttttactttttctttggattacaattatcgtacaatcgggattagtgtagataataaactctta
atgctaagaacagattacaataggggcatatcaaatctgcatttgtatgattacgatttcaagcaagttcttgatacagg
aattaagttggccgtcatgaaatatggcgaaatcgaattcttgtattcaactgcttatg
back to top
>AY805054.1-SFB.m11093
atgccattttcatgtaagaaagaaatcttaactgacatcctggtaagactacctgcaaaatcactcgttcgatttctgtg
tacatccaagttatggagtgatttgattggcagctcgagctttgctagcatgcaccttcataggaatgtcgcaaaacatg
cccatgtctatctcctctgcctccaccacccaaatgttagacgtcaggtccaccctgatgacccatatgttcaacaagaa
tttcaatggtctcttttttccaatgaaacatctgagaagtgtttcaagttatgccatcccctagggagcacagaatattt
tgtgatatatggttcaagcaacggtttagtttgcgtttcggatgagatattgaatttcgatagtcctatacacatatgga
acccatcggttaggaaatttaggaccattccaatgagcaccaatactaacatcaaatttgcctatcttgctctccacttc
gggttccaccctgggattaatgactacaaggcggtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggttta
tagtcttagaacagactcttggaagatgattgaagctattcctccatggttaaaatgcacttggcagcatcataagggta
cattctttgatggggtatcatatcacatcattgagaaaggtcctatattcagtattgtgtcctttgattcaagcagcgaa
gtattcgaagaattcatagcaccagatgccatttgccgtccatttgctttatgtattgatgttttcaaggagcaaatttg
cttgctttttagatattattcttgtgcggaggaggacatggcaaaaaatgacttatgggttctggaagaaaaacggtgga
aacaaatgtgtccttttatttatcctcttgatagttatggtacaatcgggattagtatgggtaatgaactcttaatggaa
agaagagatttcattaagggcgtaggagatctgtgtttgtgtaattacgaatccaagcaagttcttgaaacaggaattga
gttggccgtaacgaaatatggcgaaatggaattcttgtttgcaatgacttaca
back to top
>AY805053.1-SFB.m11099
atggcattcacactacgtaagaaagaaatcttgatcgacatcctacaaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggactgatttgattggaagctcgaggtttgttagcacacaccttcacaggaatgtcacaaagc
atgcccatgtctatctactctgcctccaccacccaaattttgaacgaaacgaggaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaatttaagccatcccttagggagcacagaaca
ttatgtgatatatggctcaagcaatagtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccactccaatcagcaccaatattaacattaaatttagccatatggctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaattccttcgcagttgaggt
ttatagtcttaaaacagactgctggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaagg
gtacattgtataatggagtagcataccacataattcagaaaggccctatattcagcattatgtcgtttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccctttgcagttcatgggggttatgcattgacgtttacaaggaacaaat
ttgcttgcttcttaagttttattcttgtgagttggaaggcatgaagaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgagtcctttcattttttctttggattacaattatcgtacaatcgggattagtatagataatagactctta
atgctaagaacagattacaataggggcatatcaaatttgcatttgtatgattacgatttcaagcaagttcttgatacggg
aattaagttggccgtcatgaaatatggcgaaatcgaattcttgtattcaacttcttaca
back to top
>AY805052.1-SFB.m11099
atgacattcacactacgtgagaaagaaattttaatcaacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcaagttttgtcagcacacaccttcataggaatgtcacaaaac
atgcccatgtctgtctactctgcctccaccacccaaatgttagacgccagttcaaccctgatgacccatatgttaaacaa
gaatgccaatggtctcttttttccattgaaacatttgaggagcgctccaagttaacccatcccttaaggagcacagaaca
ttatgggatatatggttcaagcaatggtttaatttgcatttcggatgagatattgaatttcgatagtcctatatacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacattaaatttagctatgttgatctccaa
ttcgggttccacccccggtttaatgactacaaggctgtaaggatgatgcgtacgaacaaaaatgctttcacagttgaggt
ttatagtcttagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcaatccaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcgctccatggggattatgtattgacgtctacaagggacaaat
ttgcttgctttttatgtgctttggttgtgaggaggagggcatggacaaagttgacttatgggttctgcaaggaaaacgat
ggaaacaattgtgtccttttgtttttcctttcggttattgtgatcttttactcgggattagtatagataatgaactcata
atgggaacaaaagatttcgataagggcgtaggaaatctgtatttgtgtagttacgaatccaagcacgttcttgaaacagg
aattaagttggggatcatgacatatggggaaatcgaattcttgttttcaattacttaca
back to top
>AY805051.1-SFB.m11096
atgacattcacactacgtaagaaagatatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggattgatttgattggcagctccagttttatcagcacacaccttcataggaatgccacaaaac
atacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaaca
ttatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatat
ggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacattaaatttagccatgttgctctccaa
ttcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagt
gatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatgtattgacatttacaaggaacgagt
ttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgat
ggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggataactatagataataaactcttaatg
gtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtccaagcaagtttttgaaacaggaat
tgagttggccgtcatgaaatatggtgaaatcgaattattgtttgcaattacttatg
back to top
>AY805049.1-SFB.m11102
atgatattcgcactacgtaagaaagaaaccttaatcgacattctagtaagactgccttcaaaatccctcgttcgatttct
ctttacatgcaaatcgtggagtgatttgatttgcagctcgagttttgttagcacacaacttcataggaatgtcacaaaac
atgcccaaatctatctgctttgtctccaccacccaaattttgaacggaacgacgacccagatgacccatatgttaagcaa
gaatttcactggtctcttttttcaaatgaaacatttgaggagtgctccaagttaagccatcccctagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctttacacatat
ggaacccatcggtcaggaaacttaggacccctccaatcagcaccaacattagcatcaaatttagccatgttgctctgcaa
tttgggttccaccctgaggttaatgactacaaggttgtaaggatgatgcgcaccaacaaaaatgccttggcggttgaggt
ttatagtcttagaagagaccgttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattcagaaaggtcctctattcagcattatgtccttcgattcaggcagt
gaagtttttgaagaattcatagcaccagatgctatttgcaatttatggggtttatgtatccaggtttacaaggaacaaat
ttgcttgctttctggattttatggttgtgaggaggagggcatggaaaaaattgacttctgggttctgcaagaaaaccggt
ggaaacaattgtgtccttttatttatgatcctttggattattgtcatcgtataatcgggattagtatagataatgaactc
ttgatggaaagagaagatttccttcggggcgtagggtatctgcatttgtgtaattacgaatccaagcaagttcttgaaac
aggaattgagttggctgttatgaaatatggcgaaatcgaattctcgtatgcaattacttata
back to top
>EU035976.1-SFB.m11125
atgacattcacactacgtgagaaagaaattttaatcaacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcaagttttgtcagcacacaccttcataggaatgtcacaaaac
atgcccatgtctgtctactctgcctccaccacccaaatgttagacgccagttcaaccctgatgacccatatgttaaacaa
gaatgccaatggtctcttttttccattgaaacatttgaggagcgctccaagttaacccatcccttaaggagcacagaaca
ttatgggatatatggttcaagcaatggtttaatttgcatttcggatgagatattgaatttcgatagtcctatatacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacattaaatttagctatgttgatctccaa
ttcgggttccacccccggtttaatgactacaaggctgtaaggatgatgcgtacgaacaaaaatgctttcacagttgaggt
ttatagtcttagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcaatccaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcgctccatggggattatgtattgacgtctacaagggacaaat
ttgcttgctttttatgtgctttggttgtgaggaggagggcatggacaaagttgacttatgggttctgcaaggaaaacgat
ggaaacaattgtgtccttttgtttttcctttcggttattgtgatcttttactcgggattagtatagataatgaactcata
atgggaacaaaagatttcgataagggcgtaggaaatctgtatttgtgtagttacgaatccaagcacgttcttgaaacagg
aattaagttggggatcatgacatatggggaaatcgaattcttgttttcaattacttacacagaaagtttggttttactca
attaa
back to top
>EU077238.1-SFB.m11085
atgacattcacactacgtaagaaagatatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggattgatttgattggcagctccagttttatcagcacacaccttcataggaatgccacaaaac
atacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaaca
ttatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatat
ggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacattaaatttagccatgttgctctccaa
ttcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagt
gatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatgtattgacatttacaaggaacgagt
ttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgat
ggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggataactatagataataaactcttaatg
gtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtccaagcaagtttttgaaacaggaat
tgagttggccgtcatgaaatatggtgaaatcgaattattgtttgc
back to top
>EU077237.1-SFB.m1861
atgatattctcactgcgtaaggaagaaatcttaatagacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggagtgatttggttggcagctcgagttttgtcagcacacaccttcataggaatatcacaaaac
atgcccatgtccatctactctgcctccaccacccaaatgttagacgtcaggtcaatcctgatgacccatatgttacacaa
gaatttcaatggtctctctttcccaatgaaacatttgaggagtgttccaaattaagccatcctttagggagcacagaaca
ttatgggatatatggttcaagtaatggtttagtttgcatctcggatgagatattgaatttcgatagtcctatactcatgt
ggaacccatcagttaggaaatttaggaccgctccaacgagcaccaacattaaccttaagtttgcctatgttgctctccaa
ttcggcttccaccatgcggttaatgactacaaggttgtaaggatgatgcgcaccaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatagag
gtacgttttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgcggtttgcagttcttggggtttatgtattgacgtttacaatgaccaaat
ttgcttgctttctggattttatggttgtgaggatgagggcttggacaaaattgacttatag
back to top
>DQ385844.1-SFB.m11131
atgagatttacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggaagcttgagttttgtgagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatctactttgcctccactactcaaattttgaacttcaggctgatcccgatgacccacatgttaaacaa
gaatttcaatggtctcttttttccaatcaaacatttgaggagtgctccaagttaagccatcccttagggatcacagaaca
ttatgtgatgtatggctcaagcaatggattaatttgcatttcggatgagatactgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccaccccaatcagcaccaacattaacattaaatttagccacgttgctctccaa
ttcggattccaccccggagttaatgactgcaaggctgtaaggatgatgcgtaccaacaaaaataccttagcggttgaggt
ttatagtcttaaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcttaagg
gtacaatttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcttttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcagttcatgggggttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttaagttttattcttgtgaggtggaaggcatgaagaaaatcgacttatgggctctgcaagaaaaacggt
ggaaacaattgtgtccttttactttttctttggattacaattatcgtacaatcgggattagtgtagataataaactctta
atgctaagaacagattacaataggggcatatcaaatctgcatttgtatgattacgatttcaagcaagttcttgatacagg
aattaagttggccgtcatgaaatatggcgaaatcgaattcttgtattcaactgcttacatagaaagtttggttttactca
ataattattaa
back to top
>AY805050.1-SFB.m11102
atgacattctcactgcgtaaggaagaaatcttaatagacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggagtgatttggttggcagctcgagttttgtcagcacacaccttcataggaatatcacaaaac
atgcccatgtccatctactctgcctccaccacccaaatgttagacgtcaggtcaatcctgatgacccatatgttacacaa
gaatttcaatggtctctctttcccaatgaaacatttgaggagtgttccaagttaagccatcctttagggagcacagaaca
ttatgggatatatggttcaagtaatggtttagtttgcatctcggatgagatattgaatttcgatagtcctatactcatgt
ggaacccatcagttaggaaatttaggaccgctccaacgagcaccaacattaaccttaagtttgcctatgttgctctccaa
ttcggcttccaccatgcggttaatgactacaaggttgtaaggatgatgcgcaccaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcacagag
gtacgttttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgcggtttgcagttcttggggtttatgtattgacgtttacaatgaccaaat
ttgcttgctttctggattttatggttgtgaggatgagggcttggacaaaattgacttatgggttttgcaagaaaaacagt
ggaaagaattgtgtcctgttatttttcctcctttgggtgattgtgatcgtataatcgggattagtataggtattgaactc
ttaatggaaaaaaaagatttcgataagggcgtaggagagctgtatttgtgtaattacgaatccaagcaagttcttcaaac
aggtattaagttggcggtcatgaaatatgacgaaatcgaattcgtgtttgcaattacttaca
back to top
>AY805048.1-SFB.m11099
atggcatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccgtggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagc
gaagaatttgaagagttcatagcaccagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggt
ggaaacaattgtgcccttttatttattcttcagattattgttatcgtacaatcgggattagtatagataatgaactctta
acggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttacg
back to top