SFB, SFB (gene) Prunus domestica

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus domestica
Synonym S haplotype-specific F-box protein
Description pollen determinant in self-incompatibility reaction
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAM746957.1-SFBPrunus domesticagene
SFBAM746956.1-SFBPrunus domesticagene
SFBAM746955.1-SFBPrunus domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAM746957.1-SFB.m1Prunus domesticamRNA
SFBAM746956.1-SFB.m1Prunus domesticamRNA
SFBAM746955.1-SFB.m1Prunus domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM746957.1-SFB N/A AM746957.1
gene parsed from NCBI nr database AM746956.1-SFB scaffold_6:26422427..26423414
AM746956.1
gene parsed from NCBI nr database AM746955.1-SFB N/A AM746955.1
mRNA parsed from NCBI nr database AM746957.1-SFB.m1 N/A AM746957.1
mRNA parsed from NCBI nr database AM746956.1-SFB.m1 scaffold_6:26422427..26423414
AM746956.1
mRNA parsed from NCBI nr database AM746955.1-SFB.m1 N/A AM746955.1

Sequence(s):
>AM746957.1-SFB989
gacatcctagtaagactgccagcaaaatcccttgttcggtttctttgtacatgcaagtcatggagtgatttgattggcag
ctcgagttttgtcagcacacaccttcataggaatgtcacaaagcatgaccatgtctatctactttgcctccaccacccaa
attttgaacgtttggtcgaccccgataacccatatgttaaaaaggaatttcgatggtctcttttttccaatgagacattt
aagcagtgctacaaattaaaccatcccttaggcagcacagaacattatgtgatatatggttcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaatccatcggttaggaaatttaggacccctccaa
tgagcactagcattaacattaaatttaattatattgctctccaatttgggttccaccccagggttaatgactacaaggca
gtaaggatgatgcgtaccaacaaagatcccttggtcgttgaggtttatagtcttagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatcataagggtatgttttttaatggaatatcataccacatcattg
agaaatgtcctatattcagcattatgtcattcgattcaggcagtgaagaattcgaagagttcatagcaccagatgtcatt
tgcagttcatgggggttatgtattgacctttacaaggaacaaatttgtttgctttctagcttttattcttgcgaggagaa
gggtatgcgaaaaattgacttctgggttctgcaagaaaaacggtggaagcaattgtgtccttttatttatccttctcatt
attatggtacactcggtatcagtatagataacgaactcttaatggaaaagagagatttctctaggggcataggagatctg
cacttgggtaattacgaatccaaacaagt
back to top
>AM746956.1-SFB992
gacatcctagtaagactgcctgcaaaatccctcgttcggtttctgtgtacatccaagtcatggagtgatttgattggcgg
ctcgagttttgttagcgcacaccttaataggaatgccacaaaacatgcccacgtctgtctactttgtctccaccacccaa
attttgaacgcctggtcaaccgtgatgacccatattttaaaaaagaatttcaatggtctcttttttccaatgaaacattt
gaggagttctccaagttaagccatcccgtagggagcacagaacattatgtgatatatggctcaagcaatggtttagtttg
catatccgatgagatactgaatttcgatagtcctatgtacatatggaacccatcagttaggaaacttaggaccactccaa
tgagcaccaacattaacgttaaatttagctatgttgctctccaattcgggttccacccccgggttaatgactacaaggct
gtagggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccgtggttaaaatgcacttggcagcattataagggtacattttttgacggagtagcatatcacgtcattc
agaaaggtcctatattcagcattatgtccttcaattcaggcaatgaagaattcgaagaatttatagcaccagatgccatt
tgcggtacatttgggttatgtatcgacatttacaaggaacaaatttgtttgctttttagatgttatggttgtgaggagga
gggcatgaacaaagttgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttttccattggatg
aatggagtggtgcaatcgggattagtatggatgatgaactcttaatggcaataacagatttcgataagggcgtagcagat
ctatatttgggtaattacgaatctaagcaggt
back to top
>AM746955.1-SFB992
gacatcctagcaagactgcctgcaaaatccctcgttcggtttttttgtacatgcaagtcatggagtgatttgattgataa
ctccagttttgttagcatacacgttaacaggaatgtcacaaaacatgcccatgtctatttactctgcctccaccacccaa
attttgaacgtcagaatgacaatgatgacccaaatgatatagaagaacttcaatggtcgcttttttccaatgaaacgttt
gagcagttctccaagttgagccatcccttagaaagcacagagcagtataggatatatggtgcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaacccgtcagttaggaaatttaggacccctccaa
tgagcaccaacattaacatgaaattttcccacgttgctctccaattcgggttccaccccggggttaatgattacaaggct
gtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggtttacagtcttaaaacagactgttggaagatgattga
agcaattcctccttggttaaaatgcactcggaagcatcataagggtacattttttaatggagtagcataccacatcattg
agaaaggtcctatatgcagcattatgtcattcgattcaggcaatgaagaattcgaagaattcatagcaccagatgacatt
tgcagttcatgggggttatgcatcgacatttacaaggaacgaatttgtttgcttcttgacttttatccttgtgaggagga
gtgcatggaaaaatttgacttttgggttctgcaagaaaaacggtggaaacaattgagtccttttatttattcttcggatt
attgttttcgtacaatcgggattagtatagataatgaactcttattggcaagaagaggtttcgatcagggcatagcagat
ctgtgtttgtgtaattacgaatccaagcaggt
back to top
>AM746957.1-SFB.m1989
gacatcctagtaagactgccagcaaaatcccttgttcggtttctttgtacatgcaagtcatggagtgatttgattggcag
ctcgagttttgtcagcacacaccttcataggaatgtcacaaagcatgaccatgtctatctactttgcctccaccacccaa
attttgaacgtttggtcgaccccgataacccatatgttaaaaaggaatttcgatggtctcttttttccaatgagacattt
aagcagtgctacaaattaaaccatcccttaggcagcacagaacattatgtgatatatggttcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaatccatcggttaggaaatttaggacccctccaa
tgagcactagcattaacattaaatttaattatattgctctccaatttgggttccaccccagggttaatgactacaaggca
gtaaggatgatgcgtaccaacaaagatcccttggtcgttgaggtttatagtcttagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatcataagggtatgttttttaatggaatatcataccacatcattg
agaaatgtcctatattcagcattatgtcattcgattcaggcagtgaagaattcgaagagttcatagcaccagatgtcatt
tgcagttcatgggggttatgtattgacctttacaaggaacaaatttgtttgctttctagcttttattcttgcgaggagaa
gggtatgcgaaaaattgacttctgggttctgcaagaaaaacggtggaagcaattgtgtccttttatttatccttctcatt
attatggtacactcggtatcagtatagataacgaactcttaatggaaaagagagatttctctaggggcataggagatctg
cacttgggtaattacgaatccaaacaagt
back to top
>AM746956.1-SFB.m1992
gacatcctagtaagactgcctgcaaaatccctcgttcggtttctgtgtacatccaagtcatggagtgatttgattggcgg
ctcgagttttgttagcgcacaccttaataggaatgccacaaaacatgcccacgtctgtctactttgtctccaccacccaa
attttgaacgcctggtcaaccgtgatgacccatattttaaaaaagaatttcaatggtctcttttttccaatgaaacattt
gaggagttctccaagttaagccatcccgtagggagcacagaacattatgtgatatatggctcaagcaatggtttagtttg
catatccgatgagatactgaatttcgatagtcctatgtacatatggaacccatcagttaggaaacttaggaccactccaa
tgagcaccaacattaacgttaaatttagctatgttgctctccaattcgggttccacccccgggttaatgactacaaggct
gtagggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccgtggttaaaatgcacttggcagcattataagggtacattttttgacggagtagcatatcacgtcattc
agaaaggtcctatattcagcattatgtccttcaattcaggcaatgaagaattcgaagaatttatagcaccagatgccatt
tgcggtacatttgggttatgtatcgacatttacaaggaacaaatttgtttgctttttagatgttatggttgtgaggagga
gggcatgaacaaagttgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttttccattggatg
aatggagtggtgcaatcgggattagtatggatgatgaactcttaatggcaataacagatttcgataagggcgtagcagat
ctatatttgggtaattacgaatctaagcaggt
back to top
>AM746955.1-SFB.m1992
gacatcctagcaagactgcctgcaaaatccctcgttcggtttttttgtacatgcaagtcatggagtgatttgattgataa
ctccagttttgttagcatacacgttaacaggaatgtcacaaaacatgcccatgtctatttactctgcctccaccacccaa
attttgaacgtcagaatgacaatgatgacccaaatgatatagaagaacttcaatggtcgcttttttccaatgaaacgttt
gagcagttctccaagttgagccatcccttagaaagcacagagcagtataggatatatggtgcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaacccgtcagttaggaaatttaggacccctccaa
tgagcaccaacattaacatgaaattttcccacgttgctctccaattcgggttccaccccggggttaatgattacaaggct
gtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggtttacagtcttaaaacagactgttggaagatgattga
agcaattcctccttggttaaaatgcactcggaagcatcataagggtacattttttaatggagtagcataccacatcattg
agaaaggtcctatatgcagcattatgtcattcgattcaggcaatgaagaattcgaagaattcatagcaccagatgacatt
tgcagttcatgggggttatgcatcgacatttacaaggaacgaatttgtttgcttcttgacttttatccttgtgaggagga
gtgcatggaaaaatttgacttttgggttctgcaagaaaaacggtggaaacaattgagtccttttatttattcttcggatt
attgttttcgtacaatcgggattagtatagataatgaactcttattggcaagaagaggtttcgatcagggcatagcagat
ctgtgtttgtgtaattacgaatccaagcaggt
back to top