SFB, SFB (gene) Prunus dulcis

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus dulcis
Synonym S-Locus F-Box protein
S-haplotype-specific F-box protein
S-locus F-box protein
S haplotype-specific F-box protein
S-haplotype-specific F-box protein 8
Description self-incompatibility
Self-incompatibility
pollen determinant in self-incompatibility reaction
Comment AcSFB
GSI SFB; GSI ligase
GSI lyase; GSI ligase
involved in self-incompatibility
F-box protein; SFb protein
GSI
self-incompatibility
acSFB
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBFN429364.1-SFBPrunus dulcisgene
SFBFN429363.1-SFBPrunus dulcisgene
SFBFN429362.1-SFBPrunus dulcisgene
SFBFN429361.1-SFBPrunus dulcisgene
SFBFN429360.1-SFBPrunus dulcisgene
SFBFN429359.1-SFBPrunus dulcisgene
SFBFN429358.1-SFBPrunus dulcisgene
SFBFN429357.1-SFBPrunus dulcisgene
SFBEU310402.2-SFBPrunus dulcisgene
SFBEU293149.1-SFBPrunus dulcisgene
SFBFJ887788.1-SFBPrunus dulcisgene
SFBFJ887787.1-SFBPrunus dulcisgene
SFBFJ887786.1-SFBPrunus dulcisgene
SFBFJ514940.1-SFBPrunus dulcisgene
SFBFJ514939.1-SFBPrunus dulcisgene
SFBFJ514938.1-SFBPrunus dulcisgene
SFBFJ514937.1-SFBPrunus dulcisgene
SFBFJ514936.1-SFBPrunus dulcisgene
SFBFJ514935.1-SFBPrunus dulcisgene
SFBFJ231204.1-SFBPrunus dulcisgene
SFBAM711127.1-SFBPrunus dulcisgene
SFBAM711126.1-SFBPrunus dulcisgene
SFBAM711125.1-SFBPrunus dulcisgene
SFBEU310403.1-SFBPrunus dulcisgene
SFBEU293148.1-SFBPrunus dulcisgene
SFBEU293147.1-SFBPrunus dulcisgene
SFBAM746960.1-SFBPrunus dulcisgene
SFBAM746959.1-SFBPrunus dulcisgene
SFBAM746958.1-SFBPrunus dulcisgene
SFBDQ983371.1-SFBPrunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBFN429364.1-SFB.m1Prunus dulcismRNA
SFBFN429363.1-SFB.m1Prunus dulcismRNA
SFBFN429362.1-SFB.m1Prunus dulcismRNA
SFBFN429361.1-SFB.m1Prunus dulcismRNA
SFBFN429360.1-SFB.m1Prunus dulcismRNA
SFBFN429359.1-SFB.m1Prunus dulcismRNA
SFBFN429358.1-SFB.m1Prunus dulcismRNA
SFBFN429357.1-SFB.m1Prunus dulcismRNA
SFBFJ415321.1-SFB.m1Prunus dulcismRNA
SFBFJ362529.1-SFB.m1Prunus dulcismRNA
SFBFJ362528.1-SFB.m1Prunus dulcismRNA
SFBFJ362527.1-SFB.m1Prunus dulcismRNA
SFBFJ362526.1-SFB.m1Prunus dulcismRNA
SFBFJ362525.1-SFB.m1Prunus dulcismRNA
SFBFJ362524.1-SFB.m1Prunus dulcismRNA
SFBEU310402.2-SFB.m1Prunus dulcismRNA
SFBEU293149.1-SFB.m1Prunus dulcismRNA
SFBFJ887788.1-SFB.m1Prunus dulcismRNA
SFBFJ887787.1-SFB.m1Prunus dulcismRNA
SFBFJ887786.1-SFB.m1Prunus dulcismRNA
SFBFJ514940.1-SFB.m1Prunus dulcismRNA
SFBFJ514939.1-SFB.m1Prunus dulcismRNA
SFBFJ514938.1-SFB.m1Prunus dulcismRNA
SFBFJ514937.1-SFB.m1Prunus dulcismRNA
SFBFJ514936.1-SFB.m1Prunus dulcismRNA
SFBFJ514935.1-SFB.m1Prunus dulcismRNA
SFBFJ231204.1-SFB.m1Prunus dulcismRNA
SFBEU909685.1-SFB.m1Prunus dulcismRNA
SFBAM711127.1-SFB.m1Prunus dulcismRNA
SFBAM711126.1-SFB.m1Prunus dulcismRNA
SFBAM711125.1-SFB.m1Prunus dulcismRNA
SFBEU310403.1-SFB.m1Prunus dulcismRNA
SFBEU293148.1-SFB.m1Prunus dulcismRNA
SFBEU293147.1-SFB.m1Prunus dulcismRNA
SFBAM746960.1-SFB.m1Prunus dulcismRNA
SFBAM746959.1-SFB.m1Prunus dulcismRNA
SFBAM746958.1-SFB.m1Prunus dulcismRNA
SFBEF061758.1-SFB.m1Prunus dulcismRNA
SFBDQ983371.1-SFB.m2Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database FN429364.1-SFB N/A FN429364.1
gene parsed from NCBI nr database FN429363.1-SFB N/A FN429363.1
gene parsed from NCBI nr database FN429362.1-SFB N/A FN429362.1
gene parsed from NCBI nr database FN429361.1-SFB N/A FN429361.1
gene parsed from NCBI nr database FN429360.1-SFB N/A FN429360.1
gene parsed from NCBI nr database FN429359.1-SFB N/A FN429359.1
gene parsed from NCBI nr database FN429358.1-SFB N/A FN429358.1
gene parsed from NCBI nr database FN429357.1-SFB N/A FN429357.1
gene parsed from NCBI nr database EU310402.2-SFB N/A EU310402.2
gene parsed from NCBI nr database EU293149.1-SFB N/A EU293149.1
gene parsed from NCBI nr database FJ887788.1-SFB scaffold_3:2485363..2498222
FJ887788.1
gene parsed from NCBI nr database FJ887787.1-SFB N/A FJ887787.1
gene parsed from NCBI nr database FJ887786.1-SFB N/A FJ887786.1
gene parsed from NCBI nr database FJ514940.1-SFB N/A FJ514940.1
gene parsed from NCBI nr database FJ514939.1-SFB N/A FJ514939.1
gene parsed from NCBI nr database FJ514938.1-SFB N/A FJ514938.1
gene parsed from NCBI nr database FJ514937.1-SFB N/A FJ514937.1
gene parsed from NCBI nr database FJ514936.1-SFB N/A FJ514936.1
gene parsed from NCBI nr database FJ514935.1-SFB N/A FJ514935.1
gene parsed from NCBI nr database FJ231204.1-SFB N/A FJ231204.1
gene parsed from NCBI nr database AM711127.1-SFB N/A AM711127.1
gene parsed from NCBI nr database AM711126.1-SFB N/A AM711126.1
gene parsed from NCBI nr database AM711125.1-SFB N/A AM711125.1
gene parsed from NCBI nr database EU310403.1-SFB N/A EU310403.1
gene parsed from NCBI nr database EU293148.1-SFB N/A EU293148.1
gene parsed from NCBI nr database EU293147.1-SFB N/A EU293147.1
gene parsed from NCBI nr database AM746960.1-SFB N/A AM746960.1
gene parsed from NCBI nr database AM746959.1-SFB N/A AM746959.1
gene parsed from NCBI nr database AM746958.1-SFB N/A AM746958.1
gene parsed from NCBI nr database DQ983371.1-SFB N/A DQ983371.1
mRNA parsed from NCBI nr database FN429364.1-SFB.m1 N/A FN429364.1
mRNA parsed from NCBI nr database FN429363.1-SFB.m1 N/A FN429363.1
mRNA parsed from NCBI nr database FN429362.1-SFB.m1 N/A FN429362.1
mRNA parsed from NCBI nr database FN429361.1-SFB.m1 N/A FN429361.1
mRNA parsed from NCBI nr database FN429360.1-SFB.m1 N/A FN429360.1
mRNA parsed from NCBI nr database FN429359.1-SFB.m1 N/A FN429359.1
mRNA parsed from NCBI nr database FN429358.1-SFB.m1 N/A FN429358.1
mRNA parsed from NCBI nr database FN429357.1-SFB.m1 N/A FN429357.1
mRNA parsed from NCBI nr database FJ415321.1-SFB.m1 N/A FJ415321.1
mRNA parsed from NCBI nr database FJ362529.1-SFB.m1 N/A FJ362529.1
mRNA parsed from NCBI nr database FJ362528.1-SFB.m1 N/A FJ362528.1
mRNA parsed from NCBI nr database FJ362527.1-SFB.m1 N/A FJ362527.1
mRNA parsed from NCBI nr database FJ362526.1-SFB.m1 N/A FJ362526.1
mRNA parsed from NCBI nr database FJ362525.1-SFB.m1 N/A FJ362525.1
mRNA parsed from NCBI nr database FJ362524.1-SFB.m1 N/A FJ362524.1
mRNA parsed from NCBI nr database EU310402.2-SFB.m1 N/A EU310402.2
mRNA parsed from NCBI nr database EU293149.1-SFB.m1 N/A EU293149.1
mRNA parsed from NCBI nr database FJ887788.1-SFB.m1 scaffold_3:2485363..2498222
FJ887788.1
mRNA parsed from NCBI nr database FJ887787.1-SFB.m1 N/A FJ887787.1
mRNA parsed from NCBI nr database FJ887786.1-SFB.m1 N/A FJ887786.1
mRNA parsed from NCBI nr database FJ514940.1-SFB.m1 N/A FJ514940.1
mRNA parsed from NCBI nr database FJ514939.1-SFB.m1 N/A FJ514939.1
mRNA parsed from NCBI nr database FJ514938.1-SFB.m1 N/A FJ514938.1
mRNA parsed from NCBI nr database FJ514937.1-SFB.m1 N/A FJ514937.1
mRNA parsed from NCBI nr database FJ514936.1-SFB.m1 N/A FJ514936.1
mRNA parsed from NCBI nr database FJ514935.1-SFB.m1 N/A FJ514935.1
mRNA parsed from NCBI nr database FJ231204.1-SFB.m1 N/A FJ231204.1
mRNA parsed from NCBI nr database EU909685.1-SFB.m1 N/A EU909685.1
mRNA parsed from NCBI nr database AM711127.1-SFB.m1 N/A AM711127.1
mRNA parsed from NCBI nr database AM711126.1-SFB.m1 N/A AM711126.1
mRNA parsed from NCBI nr database AM711125.1-SFB.m1 N/A AM711125.1
mRNA parsed from NCBI nr database EU310403.1-SFB.m1 N/A EU310403.1
mRNA parsed from NCBI nr database EU293148.1-SFB.m1 N/A EU293148.1
mRNA parsed from NCBI nr database EU293147.1-SFB.m1 N/A EU293147.1
mRNA parsed from NCBI nr database AM746960.1-SFB.m1 N/A AM746960.1
mRNA parsed from NCBI nr database AM746959.1-SFB.m1 N/A AM746959.1
mRNA parsed from NCBI nr database AM746958.1-SFB.m1 N/A AM746958.1
mRNA parsed from NCBI nr database EF061758.1-SFB.m1 N/A EF061758.1
mRNA parsed from NCBI nr database DQ983371.1-SFB.m2 N/A DQ983371.1

Sequence(s):
>FN429364.1-SFB1098
atgacattcacactacgtaagaaagaaattttgatcaacatcctagcaagactacctgcaaaatccctggttcggtttct
gtgtacatgcaagtcatggagtgatttgataggcagctccagttttgtcagcacacaccttcacaggaatgtcacaaaac
attcccatgtctatctactttgcctccaccacccaaattttgaatgtgtggtggaccttgatgacccatattcagacgaa
gaagttcaatggtctcttttttccaatgaaacgtttgagcagagctccaagttaagccatcccttagggagcacaaaaca
ttatgggatatatggttcttcaagcaatggtttagtttgcatttcggatgagatattaaatttcgatagtcctatacaca
tatggaacccatctgttaggaaatttaggacccctgcaatgagcaccaacaacattaaatttagctatgttgctctccag
ttcgggttccatcctggggttaatgaccacaaggttgtaaggatgatgcgtaataacaaagatgacttcgcagttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcagttggcagcatcataagg
gtacattctttaatggagtagcataccacatcattgaggaaaattctatattaagcattatgtctttcgattcagacagt
gaagaatttgaagtattcatagcaccagatgccatttgcagttcatggggattatgtattgacgtttacaaggaacaaat
ttgcttgctttttgactgttatccttgtgacgaggagggaatggaaaaaattgacttatgggttctgcaagaaaaagggt
ggaaacaattgtgtccttttgtttatccttctggttatgattataaaccaattggcattagcatagatagtgaactcttt
atggaaatgagagatttcgataggggcgtagcaggtctgcatttgtgtcattacgaacccaagcaagttcttgaaacagg
aattgagttggccctcatgaaatatggcgaaatggaattcttctttgcaattacttat
back to top
>FN429363.1-SFB1098
atggcattcaccctacgtaagaaagaaatcttgatcgacatcctagtgagactacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaatgtcacaaagc
atgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccatattttaaaaag
gaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttagggagcacagaaca
ttattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcccatacacatat
ggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattgtttctctccag
tttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtggcaattgaggt
ttatagttttagaacagaatcttggaagatgattgaagcaattcctccttggctaaaatgcacttggcaacatcataagg
ggatttttttaaatggagcagcatacgatatcattgagaaaggtcctatattcagcgttatgtcattcgattcaggcagt
gaagaattcaaagaattcatagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttacaagggacaaat
ttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaactgccttcttttatttatcctttgggttattgttttggtataattgggattaatatagacaatgaactctta
atgggaagaagagatttagccaaaggcgtagcagatctgtatttttgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcctcattgtatatggggaaatcgaattcttgttttcaattacttac
back to top
>FN429362.1-SFB1098
atgacattcacactacgtaagaaagaaattttgatcaacatcctagcaagactacctgcaaaatccctggttcggtttct
gtgtacatgcaagtcatggagtgatttgataggcagctccagttttgtcagcacacaccttcacaggaatgtcacaaaac
attcccatgtctatctactttgcctccaccacccaaattttgaatgtgtggtggaccttgatgacccatattcagacgaa
gaagttcaatggtctcttttttccaatgaaacgtttgagcagagctccaagttaagccatcccttagggagcacaaaaca
ttatgggatatatggttcttcaagcaatggtttagtttgcatttcggatgagatattaaatttcgatagtcctatacaca
tatggaacccatctgttaggaaatttaggacccctgcaatgagcaccaacaacattaaatttagctatgttgctctccag
ttcgggttccatcctggggttaatgaccacaaggttgtaaggatgatgcgtaataacaaagatgacttcgcagttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcagttggcagcatcataagg
gtacattctttaatggagtagcataccacatcattgaggaaaattctatattaagcattatgtctttcgattcagacagt
gaagaatttgaagtattcatagcaccagatgccatttgcagttcatggggattatgtattgacgtttacaaggaacaaat
ttgcttgctttttgactgttatccttgtgacgaggagggaatggaaaaaattgacttatgggttctgcaagaaaaagggt
ggaaacaattgtgtccttttgtttatccttctggttatgattataaaccaattggcattagcatagatagtgaactcttt
atggaaatgagagatttcgataggggcgtagcaggtctgcatttgtgtcattacgaacccaagcaagttcttgaaacagg
aattgagttggccctcatgaaatatggcgaaatggaattcttctttgcaattacttat
back to top
>FN429361.1-SFB1098
atggcattcaccctacgtaagaaagaaatcttgatcgacatcctagtgagactacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaatgtcacaaagc
atgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccatattttaaaaag
gaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttagggagcacagaaca
ttattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcccatacacatat
ggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattgtttctctccag
tttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtggcaattgaggt
ttatagttttagaacagaatcttggaagatgattgaagcaattcctccttggctaaaatgcacttggcaacatcataagg
ggatttttttaaatggagcagcatacgatatcattgagaaaggtcctatattcagcgttatgtcattcgattcaggcagt
gaagaattcaaagaattcatagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttacaagggacaaat
ttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaactgccttcttttatttatcctttgggttattgttttggtataattgggattaatatagacaatgaactctta
atgggaagaagagatttagccaaaggcgtagcagatctgtatttttgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcctcattgtatatggggaaatcgaattcttgttttcaattacttac
back to top
>FN429360.1-SFB1098
atggcattcaccctacgtaagaaagaaatcttgatcgacatcctagtgagactacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaatgtcacaaagc
atgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccatattttaaaaag
gaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttagggagcacagaaca
ttattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcccatacacatat
ggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattgtttctctccag
tttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtggcaattgaggt
ttatagttttagaacagaatcttggaagatgattgaagcaattcctccttggctaaaatgcacttggcaacatcataagg
ggatttttttaaatggagcagcatacgatatcattgagaaaggtcctatattcagcgttatgtcattcgattcaggcagt
gaagaattcaaagaattcatagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttacaagggacaaat
ttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaactgccttcttttatttatcctttgggttattgttttggtataattgggattaatatagacaatgaactctta
atgggaagaagagatttagccaaaggcgtagcagatctgtatttttgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcctcattgtatatggggaaatcgaattcttgttttcaattacttac
back to top
>FN429359.1-SFB1107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>FN429358.1-SFB1107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>FN429357.1-SFB1098
atgacatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgggttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcgagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagaaattcctccttggttaaaatgcacttggcagcatcataagg
gaacattttctaatggagtagcataccacatcatcgagaagggtcctataatcagcattatgtcattcaattcaggcagt
gaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcgaggtctacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaaggaaaacggt
ggaaacaattgtgccctttcatttattcttcagattattgttatcgtacaatcgggattagtatagatgatgaactctta
atggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttac
back to top
>EU310402.2-SFB1040
cttgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcatag
gaatgtcagaaaacatgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacc
catatgttgaacaagaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtca
gggagcacagaacattatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagcc
atgttgctctgcaattcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgcc
ttggcggttgaggtttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttg
gcagcatcataagggtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcat
ttgattcaggcagtgaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtt
tacaaggaacaaatttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttct
gcaagaaaaacggtggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatag
ataataaactcctaatgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagcca
actcaacaagttctagaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttctta
back to top
>EU293149.1-SFB812
cggtttctgtgtacgtgcaagtcatgtagtgatttgattggcagctcgagttttgtaagcatacaccttaacaggaacgt
cacaaaacatgcccatgtctatctactctgcctccaccacccaaattttgaacgtctggccgaccctgatgacccatatg
ttaaacaagaatttcactggtctctgttttcgaatgaaacatttgaggagtgctccaagttaagccatcccttggggagc
acagaacattatggggtatatggttcaagcaatggtttagtttgcatttcagatgagattttgaatttcgatagtcctat
acacatatggaacccatcggttaggaaacttaggaccactccaatgagcaccaatattaacgttaaatttagccatgttg
ctctccaattcgggttccaccctggggttaatgactacaaggctatgaggatgatgcgtaccaacaaaggtgctttggca
attgaggtttatagtctccgaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagca
tcacaggggtacaatttttaatggagtagcataccacatcattcagaaaggtcctctattcagcattatgtccttcgatt
taggcagtgaagaattcgaagaattcatagcaccagatgccatttgccgttcactggggttagggattgacgtttacaag
gaacaaatttgcttgctttttagattttatggttgtgaggaggaggacacggacaaatttgacttatgggttctgcaaga
aaaacgatggaa
back to top
>FJ887788.1-SFB506
cctatacacatatggaacccctcggttaggaaatttagaacccttccaatgagcaccaaccacaacgttaaattccgcta
cattgctctccaattcgggttccaccctggggttaacgactacaaggttgtaaggatgttgtgcgtccacaaagacaatg
cttttgcggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcact
tggcagaaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgtc
attcgattcaggcagcgaaaaattcaaagagttcatagcaccggatgccattagctgttggtcacggctgtatattgagg
tttacaaggatcaaatttgcttgctttattatttgagactgtttcattgtgaggaagaaggcatgtcacaaattgagttt
tgggttctgcaagaaaaacgatggaa
back to top
>FJ887787.1-SFB826
attcgatttctgtttacgtgcaagtcatggatggatttgattggcagctcgagttttgttagcacacaccttcataggaa
tgtcacaaaacatgcccatgtctctctactctgcctccaccaccaaagttttgaatgtcaggttgaccctgatgacccat
atgttggacaagaacttcaatggtctcttttttgcgacgaaacatttgtgctctgctccaagttaagccatcccttaggg
agcacagaacaatactatgggatatatggttcaagcaatggtttagtttgcatttcggacgagatattgaattttgatag
tcctatatacatatggaacccatcggtcaggaaacttaggacccctccactgagcaccaacattaacattaaatttagcc
atgttgctctccaattcgggttccaccctggggttaacgactacaaggttgtaaggatgttgtgcgtccacaaagacaat
gcttttgcggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcac
ttggcagaaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgt
cattcgattcaggcagcgaaaaattcaaagagttcatagcaccggatgccattagctgttggtcacggctgtatattgag
gtttacaaggatcaaatttgcttgctttattatttgagactgtttcattgtgaggaagaaggcatgtcacaaattgagtt
ttgggttctgcaagaaaaacgatgga
back to top
>FJ887786.1-SFB826
attcgatttctgtttacgtgcaagtcatggatggatttgattggcagctcgagttttgttagcacacaccttcataggaa
tgtcacaaaacatgcccatgtctctctactctgcctccaccaccaaagttttgaatgtcaggttgaccctgatgacccat
atgttggacaagaacttcaatggtctcttttttgcgacgaaacatttgtgctctgctccaagttaagccatcccttaggg
agcacagaacaatactatgggatatatggttcaagcaatggtttagtttgcatttcggacgagatattgaattttgatag
tcctatatacatatggaacccatcggtcaggaaacttaggacccctccactgagcaccaacattaacattaaatttagcc
atgttgctctccaattcgggttccaccctggggttaacgactacaaggttgtaaggatgttgtgcgtccacaaagacaat
gcttttgcggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcac
ttggcagaaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgt
cattcgattcaggcagcgaaaaattcaaagagttcatagcaccggatgccattagctgttggtcacggctgtatattgag
gtttacaaggatcaaatttgcttgctttattatttgagactgtttcattgtgaggaagaaggcatgtcacaaattgagtt
ttgggttctgcaagaaaaacgatgga
back to top
>FJ514940.1-SFB1128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaactttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttatatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagtacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaactc
ataatggcaagaaaagatttcagtaagggcggagtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcatgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>FJ514939.1-SFB1128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaactttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttacatttgaagagagctccaagctaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcgtcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggacattatagttgtgaggaggatggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaaccc
ataatggcaagaaaagatttcagtaagggcggagtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcatgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>FJ514938.1-SFB1128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaattttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttacatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgatccaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaactc
ataatggcaagaaaagatttcagtaagggcggagtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcgtgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>FJ514937.1-SFB1125
atggcattcatactacgtaagaaagaaatcttgatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcgtggagtgattttattggcagccagagttttgttagcacacaccttcataggaatgtcactggac
atgcccatgcctatctactttgcctccaccacccaaattttgaatgtcaaagggacgatgatgacccatatgttaaagaa
gaactccagtggtcacttttttccaatgaaacatttaagcagtgcttcaagttaaaccatcctttagaaaatacagagca
ttataggatatatggttcaagcagtggtttagtttgcatttcggatgtgatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggactcttccaatgagcaccaacattaaccttaagtttgcctatgttgctctccaa
ttcgggttccacccgggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgccttggcggttgaggt
ttttagtcttggaacagactcttggaagatgattgaaggaattcctccttggttaaaatgcacttggaaacatcataacg
gtacattttttaatggagtagcatatcacataattgagaaaggccctatattcagcattatgtcattcgattcaggcagc
gaagaactcgaagaattcatagcaccagatgccatttgcagtccatgtgagttatggattgacgtttacaacgaacaaat
ttgcttgcttcttgaattgtatccttgtgcggaagagggtatggacaaaattgacttatggattctgcaagaaaaacggt
ggaaaccattgtgtccgtttatttatcctttggatcattattattgtacaattgggattagtatagataataaactctta
atgattagaaaagatgacatgaagggcatagcagacctgcatgtgtgtgattacggatccaagaaaagtcttaagacagg
aattaagttagccaatatgaaatatggcgaaatcgaatttttgttttcaatttcatacgtagaaagtttgcttttactca
attaa
back to top
>FJ514936.1-SFB1122
atggcattcatactacgtaagaaagaaatcttaatagacatcctggtgagactacctgcaaaatccctggttcggtttct
gtgcacatgcaagtcatggagtgatttgattggcagctccagtttagttagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatttactttgtctccaccactcaaattttgaacttcaggctgaccctgatgacccatatgttaaacaa
gaatttcaatggtcccttttttccaatcaaacatttgagcagtgctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggctcaagcaatggtctagtttgtatttcggatgagatattgaatttcgatactcctatacacatat
ggaacccatcggttaggaaacttagggcccttccaatcagcaccaacattaacattaaatttagtcatgttgctctccaa
ttcgggtttcaccccgtggttaatgactacaaggctgtaaggatgatgcgcaccaacaaaaatcccttggcggttgaggt
ttatagtcttagaacagactcttggaaaatgattgaagtacttccgccttggttaaaatgcacttggaaacatcataagg
gtacatttcttaatggagtagcataccacatgattcagaaaggtcctatattcagcattgtgtcgtttgattcaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcaatccatgtgagctggtacgtattgacgtttacaaggaaca
aatttgcttgctttgtagcttgtatccttctgaggatggcatgggaaaaaatgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctcttgattgcgatggtacaatagggattagtatagataatgaactcttaatg
gaaaaaagagatttcgataggggcatagcaaatgtgcatttgtgtaattaccaatccaagcaagttcttgaaacaggaat
tgagttggccgtcatgaaatatggcgaaatggagttgctgtttgcaattacttacatagaaagtttgcttttactcaatt
aa
back to top
>FJ514935.1-SFB1128
atggcattcatactacgtaagaaagaaatcaaaatcgacatcttagtaagactacctgcaaaatcccttgttcggtttat
gtctacatgcaagtcatggagtgatttgatcggcagctcgagtcttgtcagcacacaccttgataggaatgtcactaaac
atgcccatgtctatttactttgcctcctccacccaaatgttgaacgtcaggctgaccctgatgacccctatgttaaacaa
gaatttcaatggtcattgttttccaatgaaacatttgaggagtgctccaagttaagccatcccttaaggagcacagaata
ttatgtgatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcagttaagaaatttaggacctctccaatgagcaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcacaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatctcaatg
gtacaatttttaatggagttgcataccacatcattcagaaaggttctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgtagttcattggggttatgcatccgggtttacaaggaacaaat
ctgcttgctttttgggttttatggttgtgaggaggaggatatggacaaaattgacttctgggttctacaagaaaaaaggt
ggacacaattgtgtacttttatttattatccttcggattattctcatcgtataatcgggattagtatagataatgaaatc
ttaatggaaagaagacatttccttaggggcataggatatctgcatttgtgtaattacgaatccaagcaagttcttgaaac
aggaattgagttggccgttctgaaatatggcgaaatcgaattctcttatgcaattacttacatagaaagtttgcttttac
tcaattaa
back to top
>FJ231204.1-SFB1128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagatttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaattttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttacatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ctatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaactc
ataatggcaagaaaagatttcagtaagggcggcgtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcatgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>AM711127.1-SFB1107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>AM711126.1-SFB1107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>AM711125.1-SFB1107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>EU310403.1-SFB814
gttcgatttctgtttacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaa
tgtcacaaagcatgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccat
attttaaaaaggaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttaggg
agcacagaacattattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcc
tatacacatatggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattg
tttctctccagtttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtg
gcaattgaggtttatagttttagaacagaatcttggaagatgattgaagcaattcttccttggctaaaatgcacttggca
gcatcataaggggatttttttaaatggagcagcatacgacatcattgagaaaggtcctatattcagcgttatgtcattcg
attcaggcagtgaagaattcaaagaattcttagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttac
aagggacaaatttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgca
agaaaaacgatgga
back to top
>EU293148.1-SFB816
gttcgatttctgtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaa
tgtcacgggacatgcccaggcctatctcctttgcctccaccacccaaattttgaatgtcaaagggatgatgatgacccat
attttaaagaagaactccaatggtcactgttttccaatgttacatttgaagagagctccaagttaagccatcccttaggg
agcacagaacattatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcc
tatacacatatggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatg
ttgctctccaattcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttg
gcggttgagatttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggca
gcatcatcagggtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcg
attcaggcagtgaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttac
aaggagcaaatttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgca
agaaaaacggtggaaa
back to top
>EU293147.1-SFB815
cgatttctgtgtacatgcaagtcatggagtgattttattggcagctcgggttttgttagcacacaccttgataggaatgt
cacaaaacatgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatg
ttaaaaaagaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaac
acagaacattatgggatatatggttcgagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctat
acacatatggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgttt
ctcttcaatttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcg
gttgaggtttatagtcttagaacagactcttggaagatgattcaagaaattcctccttggttaaaatgcacttggcagca
tcataagggaacattttctaatggagtagcataccacatcatcgagaagggtcctataatcagcattatgtcattcaatt
caggcagtgaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcgaggtctacaag
gaacaaatttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagg
aaaacggtggaaaca
back to top
>AM746960.1-SFB989
gacatcctagtaagactacctgcaaaatccctggttcggtttctgtgcacatgcaagtcatggagtgatttgattggcag
ctccagtttagttagcacacaccttcataggaatgtcacaaagcatgaccatgtctatttactttgtctccaccactcaa
attttgaacttcaggctgaccctgatgacccatatgttaaacaagaatttcaatggtcccttttttccaatcaaacattt
gagcagtgctccaagttaagccatcccttagggagcacagaacattatgtgatatatggctcaagcaatggtctagtttg
tatttcggatgagatattgaatttcgatactcctatacacatatggaacccatcggttaggaaacttagggcccttccaa
tcagcaccaacattaacattaaatttagtcatgttgctctccaattcgggtttcaccccgtggttaatgactacaaggct
gtaaggatgatgcgcaccaacaaaaatcccttggcggttgaggtttatagtcttagaacagactcttggaaaatgattga
agtacttccgccttggttaaaatgcacttggaaacatcataagggtacatttcttaatggagtagcataccacatgattc
agaaaggtcctatattcagcattgtgtcgtttgattcaggcagtgaagaattccaagaattcatagcaccagatgccatt
tgcaatccatgtgagctggtacgtattgacgtttacaaggaacaaatttgcttgctttgtagcttgtatccttctgagga
tggcatgggaaaaaatgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttgtttatcctcttgatt
gcgatggtacaatagggattagtatagataatgaactcttaatggaaaaaagagatttcgataggggcatagcaaatgtg
cacttgtgtaattacgaatccaagcaagt
back to top
>AM746959.1-SFB989
gacatcctagtaagacttccagcaaaatccctccttcggtttctgtgtacatgcaagtcatggagtgatttgattggcag
ctcgagttttgttagcatgcaccttcataggaatgtcagaaaacatgcccatgtgtatctcctctgcctccaccacccaa
atgttagacgtcaggtggaccctgatgacccatatgttaaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtacttcaagttaagccatcccttggggagcccagaatattttgtgatatatggttcaagcaacggtttagtttg
catttcggatgagatattgaatttcgatagcccaatacacatatggaacccatcggttaggaaatttaggaccattccaa
tgagcaccaacatcaacattaaatttagctatgttgctctccaattcgggttccacccccggattaatgactacaaggct
gtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatctgaagggtacattttttggtggagtatcataccacatcattc
agaaaggtcctatattcagcattgtgtccttcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatt
tgccgtccatttgcgttatgtattgacgtctacaaggagcaaatttgtttgctttttagattttattcttgtgcggatga
ggacatggcaaaaaatgacttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcttgata
gctatggtacaatcgggattagtatagataatgaactcttattggaaagaagagattttattaggggcataggagatcta
tgtttgtggaattatgaatccaagcaggt
back to top
>AM746958.1-SFB987
gacatcctagcaagacttactgcaaaatccctcgttcggtttgtttgtacatgcaagtcatggagtgatttgattggtag
ctccagttttgttagcatacacgttaacaggaatgtcacaaaacatgcccatgtctatttactctgcctccaccacccaa
attttgaacgtcagaatgacaatgatgacccatatgatatagaagaacttcaatggtcgcttttttccaatgaaacgttt
cagcagttctccaagttgagccatcccttagaaagcacagagcagtataggatatatggtgcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaacccgtctgttaggaaatttaggacccctccaa
tgagcaccaacattaacatgaaattttcccatgttgctctccaattcggtttccaccccggggttaatgactacaaggct
gtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggtttacagtcttaaaacatactgttggaagatgattga
agcaattcctccttggttaaaatgcacttggaagcatcataagggtacattttttaatggagtagcataccacatcattg
agaaaggtcctatatgcagcattatgtcattcgattcaggcaatgaagaattcgaagaattcatagcaccagatgacatt
tgcagttcatgggggttatgcatcgacatttacaaggaacgaatttgcttgctttttgacttttatccttgtgaggagga
gtgcatggaaaaatttgacttttgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttattcttcggatt
attgttttcgtacaatcgggattagtatagataatgaactcttattggcaagaagaggtttcgatcagggcatagcagat
ctgtgtttgtgtaattacgaatccaaa
back to top
>DQ983371.1-SFB13
ttttgctcaataa
back to top
>FN429364.1-SFB.m11098
atgacattcacactacgtaagaaagaaattttgatcaacatcctagcaagactacctgcaaaatccctggttcggtttct
gtgtacatgcaagtcatggagtgatttgataggcagctccagttttgtcagcacacaccttcacaggaatgtcacaaaac
attcccatgtctatctactttgcctccaccacccaaattttgaatgtgtggtggaccttgatgacccatattcagacgaa
gaagttcaatggtctcttttttccaatgaaacgtttgagcagagctccaagttaagccatcccttagggagcacaaaaca
ttatgggatatatggttcttcaagcaatggtttagtttgcatttcggatgagatattaaatttcgatagtcctatacaca
tatggaacccatctgttaggaaatttaggacccctgcaatgagcaccaacaacattaaatttagctatgttgctctccag
ttcgggttccatcctggggttaatgaccacaaggttgtaaggatgatgcgtaataacaaagatgacttcgcagttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcagttggcagcatcataagg
gtacattctttaatggagtagcataccacatcattgaggaaaattctatattaagcattatgtctttcgattcagacagt
gaagaatttgaagtattcatagcaccagatgccatttgcagttcatggggattatgtattgacgtttacaaggaacaaat
ttgcttgctttttgactgttatccttgtgacgaggagggaatggaaaaaattgacttatgggttctgcaagaaaaagggt
ggaaacaattgtgtccttttgtttatccttctggttatgattataaaccaattggcattagcatagatagtgaactcttt
atggaaatgagagatttcgataggggcgtagcaggtctgcatttgtgtcattacgaacccaagcaagttcttgaaacagg
aattgagttggccctcatgaaatatggcgaaatggaattcttctttgcaattacttat
back to top
>FN429363.1-SFB.m11098
atggcattcaccctacgtaagaaagaaatcttgatcgacatcctagtgagactacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaatgtcacaaagc
atgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccatattttaaaaag
gaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttagggagcacagaaca
ttattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcccatacacatat
ggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattgtttctctccag
tttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtggcaattgaggt
ttatagttttagaacagaatcttggaagatgattgaagcaattcctccttggctaaaatgcacttggcaacatcataagg
ggatttttttaaatggagcagcatacgatatcattgagaaaggtcctatattcagcgttatgtcattcgattcaggcagt
gaagaattcaaagaattcatagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttacaagggacaaat
ttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaactgccttcttttatttatcctttgggttattgttttggtataattgggattaatatagacaatgaactctta
atgggaagaagagatttagccaaaggcgtagcagatctgtatttttgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcctcattgtatatggggaaatcgaattcttgttttcaattacttac
back to top
>FN429362.1-SFB.m11098
atgacattcacactacgtaagaaagaaattttgatcaacatcctagcaagactacctgcaaaatccctggttcggtttct
gtgtacatgcaagtcatggagtgatttgataggcagctccagttttgtcagcacacaccttcacaggaatgtcacaaaac
attcccatgtctatctactttgcctccaccacccaaattttgaatgtgtggtggaccttgatgacccatattcagacgaa
gaagttcaatggtctcttttttccaatgaaacgtttgagcagagctccaagttaagccatcccttagggagcacaaaaca
ttatgggatatatggttcttcaagcaatggtttagtttgcatttcggatgagatattaaatttcgatagtcctatacaca
tatggaacccatctgttaggaaatttaggacccctgcaatgagcaccaacaacattaaatttagctatgttgctctccag
ttcgggttccatcctggggttaatgaccacaaggttgtaaggatgatgcgtaataacaaagatgacttcgcagttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcagttggcagcatcataagg
gtacattctttaatggagtagcataccacatcattgaggaaaattctatattaagcattatgtctttcgattcagacagt
gaagaatttgaagtattcatagcaccagatgccatttgcagttcatggggattatgtattgacgtttacaaggaacaaat
ttgcttgctttttgactgttatccttgtgacgaggagggaatggaaaaaattgacttatgggttctgcaagaaaaagggt
ggaaacaattgtgtccttttgtttatccttctggttatgattataaaccaattggcattagcatagatagtgaactcttt
atggaaatgagagatttcgataggggcgtagcaggtctgcatttgtgtcattacgaacccaagcaagttcttgaaacagg
aattgagttggccctcatgaaatatggcgaaatggaattcttctttgcaattacttat
back to top
>FN429361.1-SFB.m11098
atggcattcaccctacgtaagaaagaaatcttgatcgacatcctagtgagactacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaatgtcacaaagc
atgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccatattttaaaaag
gaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttagggagcacagaaca
ttattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcccatacacatat
ggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattgtttctctccag
tttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtggcaattgaggt
ttatagttttagaacagaatcttggaagatgattgaagcaattcctccttggctaaaatgcacttggcaacatcataagg
ggatttttttaaatggagcagcatacgatatcattgagaaaggtcctatattcagcgttatgtcattcgattcaggcagt
gaagaattcaaagaattcatagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttacaagggacaaat
ttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaactgccttcttttatttatcctttgggttattgttttggtataattgggattaatatagacaatgaactctta
atgggaagaagagatttagccaaaggcgtagcagatctgtatttttgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcctcattgtatatggggaaatcgaattcttgttttcaattacttac
back to top
>FN429360.1-SFB.m11098
atggcattcaccctacgtaagaaagaaatcttgatcgacatcctagtgagactacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaatgtcacaaagc
atgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccatattttaaaaag
gaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttagggagcacagaaca
ttattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcccatacacatat
ggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattgtttctctccag
tttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtggcaattgaggt
ttatagttttagaacagaatcttggaagatgattgaagcaattcctccttggctaaaatgcacttggcaacatcataagg
ggatttttttaaatggagcagcatacgatatcattgagaaaggtcctatattcagcgttatgtcattcgattcaggcagt
gaagaattcaaagaattcatagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttacaagggacaaat
ttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgcaagaaaaacggt
ggaaacaactgccttcttttatttatcctttgggttattgttttggtataattgggattaatatagacaatgaactctta
atgggaagaagagatttagccaaaggcgtagcagatctgtatttttgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcctcattgtatatggggaaatcgaattcttgttttcaattacttac
back to top
>FN429359.1-SFB.m11107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>FN429358.1-SFB.m11107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>FN429357.1-SFB.m11098
atgacatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgggttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcgagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagaaattcctccttggttaaaatgcacttggcagcatcataagg
gaacattttctaatggagtagcataccacatcatcgagaagggtcctataatcagcattatgtcattcaattcaggcagt
gaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcgaggtctacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaaggaaaacggt
ggaaacaattgtgccctttcatttattcttcagattattgttatcgtacaatcgggattagtatagatgatgaactctta
atggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttac
back to top
>FJ415321.1-SFB.m11134
atggcattcaaacgacctaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcattcggttcct
gtgtacatgcaagttttggagtgatttgattggcagctcgagctttgttagcacacaccttcgtaggaatgtcactcaac
aggcccatgtctatttactctgcctccaccacccaaatgttgaacgtcaggctgaccctgatgacccatatgttgaacaa
gaatttcactggtctcttttttcgaaagaaacatttaaggagtgctccaagttaagctatcccttagggagcacagaaca
atattatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacaca
tatggaacccatcggttaggaaacttaggacccctccaatcagcaccaacattaacatgaaatttagccatgttgctctg
caattcgggttccaccctcgggttaatgactacaaggttgtgagaatgatgcgcaccaacaaaaatgccttggcggttga
ggtttatagtcttagaacagactcttggaggatgattgaagcaattcctccttggttaaaatgcacttggcaacatcata
agtgtacattttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtccttggattcaggc
agtgaagaattcgaagaattcatagcaccagatgccatttgtaggccttgtgagttatatattgacgtttacaaggagca
aatttgcttgctttttgactattatccttgtgaggaggaaggcatggagaaaatggacttatgggttctgcaagaaaaac
ggtggaaacagttgtgtccttttatttatccttgggattattatcatcgtacagtcgggattagtatagacaataaaatc
ttaatgctaagaagagatgacattatggggacagtagatctgcatttgtgtgattatgaatccaagcaagttcttgaaac
aggaattaagttggccactgtgaaatatggtgaaattgaattattgttttcaatttattacacagaaggtttagtcttac
tcaacaattattaa
back to top
>FJ362529.1-SFB.m11125
atggcattcaccctacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttgt
ttgtacatgcaagtcatggagtgatttgattggtagctccagttttgttagcatacacgttaacaggaatgtcacaaaac
atgcccatgtctatttactctgcctccaccacccaaattttgaacgtcagaatgacaatgatgacccatatgatatagaa
gaacttcaatggtcgcttttttccaatgaaacgtttcagcagttctccaagttgagccatcccttagaaagcacagagca
gtataggatatatggtgcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccgtctgttaggaaatttaggacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcggtttccaccccggggttaatgactacaaggctgtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggt
ttatagtcttagaacagactcttggaggatgattgaagcaattcctccttggttaaaatgcactaggaagcatcataagg
gtacattttttaatggagttgcatacaacatcgttgagaaaggtcctatattcagcattatgtcgttcaattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcaggtcgtggggattatgtatcgacgtttacaaggaacaaat
ttgcttactttttttatattatgattctggggtggagggcatggagaaaattgacttatgggttctgcaagcaaaactgt
ggaaacaattgtgccctttttattatcccatgggttattgttatggtataattgggattaatatagataatcaactctta
atgggaagaagagattgggataaaggcgtagcagatctgtatttgtgtaattacgaatccaagcaagttcttgagacagg
aattaagttgggcctcatgtcatatggggaaatcgaattcttgttttcaatttcttacatagaaagtttgcttttactca
attaa
back to top
>FJ362528.1-SFB.m11125
atggcattcatactacgtaagaaagaaatcttaatcgacatcctggtaagactacctgcaaaatcccttattcggtttct
gtgtacatgcaagtcatggagtgatttgattggaagctcaatttttgttggcacacacctttgtagcaatgtgacaaaac
atacccatgtttatctactctgcctccaccacccaaattctgaacgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctctttttcccagtgaaacatttgaggagtgctacaaactaagacatcccttagggatcaccgaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatatacatat
ggaacccatcggttaggaaatttaagacccttccattgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccctggggttaatgactacaaggcagtaagaatgatgcgtaccaacaaaggtgccctggcaattgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcactaggaagcatcataagg
gtacattttttaatggagttgcatacaacatcgttgagaaaggtcctatattcagcattatgtcgttcaattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcaggtcgtggggattatgtatcgacgtttacaaggaacaaat
ttgcttactttttttatattatgattctgaggtggagggcatggagaaaattgacttatgggttctgcaagcaaaactgt
ggaaacaattgtgccctttttattatcccatgggttattgttatggtataattgggattaatatagataatcaactctta
atgggaagaagagattgggataaaggcgtagcagatctgtatttgtgtaattacgaatccaagcaagttcttgagacagg
aattaagttgggcctcatgtcatatggggaaatcgaattcttgttttcaatttcttacatagaaagtttgcttttactca
attaa
back to top
>FJ362527.1-SFB.m11131
atggcattcatactacttaagaaagaaatcctgatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcgtggagtgattttattggcagccagagttttgttagcacacaccttcataggaatgtcactggac
atgcccatgcctatctactttgcctccaccacccaaattttgaatgtcaaagggacgatgatgacccatatgttaaagaa
gaactccagtggtcacttttttccaatgaaacatttgagcagtgcttcaagttaaaccatcctttagaaaatacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaattccgatagtcctatacacatat
ggaacccatcaattagtaaatttaggactcttccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccacccgggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgccttggcggttgaggt
ttttagtcctggaacagactcttggaagatgattgatggaattcctccttggttaaaatgcacttggaaacatcataacg
gtacatcttttaatggagtagcatatcacataattgagaaaggccctatattcagcattatgtcattcgattcaggcagc
gaagaattcgaagaattcatagcaccagatgccatttgcagtccatgtgagttatggattgacgtttacaacgaacaaat
ttgcttgcttcttgaattgtatccttgtgcggaagagggtatggacaaaattgacttatggattctgcaagaaaaacggt
ggaaaccattgtgtccgtttatttatcctttggatcattattattgtacaattgggattagtatagataataaactctta
atgattagaaaagatgacatgaagggcatagcagacctgcatgtgtgtgattacggatccaagaaaagtcttaagacagg
aattaagttagccaatatgaaatatggcgaaatcgaatttttgttttcaatttcatacgtagaaagtttggttttactca
ataattgttaa
back to top
>FJ362526.1-SFB.m11122
atggcattcatactacgtaagaaagaaatcttagtcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
tggtacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcacacaccttcataagaatgtcacaaaac
atgcccatgtctatctactttgcctccaccacccaaattttgaacgtccagacgacatgggtgatccatatgtgcagcaa
gaatttcgctggtctcttttttccgatgaaacatttgagcagtgctccaagttaggccatcccttaggaagcacagaaca
ttatgtgatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaacttcgatagtcctatacacatat
ggaacccgtcggttaggaaattaaggacccctgcaatgagcaccaacaatataaaatttgtctatgttgctcttcaattc
ggattccaccccggggttaatgattacaaggcagtaagaatgatgcataccaacaaagatgccttcgcggttgaggttta
tagtcttagaacaaactcttggaagatgattgaagcaattccaccttggttaaaatgcacttggcagcattataagggta
cattttttaatggagtagcataccacatcattcagaaaggtcctatattcagcattatgtcattcgattcaggcagtgaa
gaattcgaagagttcatagcaccagatgccgtttgcagtttatgggagttatgtatcgacgatttcaaggaacaaatttg
cttgctttttggattttatggtcgtgaggaggaggacatggacaaacttgacatttgggttctgcaagaaaaacggtgga
aacaattgtgtccttttgtttatcctttggattattatgaacgtacaatcgggattagcatagataataaactcttaatg
ctaagaagagatgacattaggggccaaccagatctgcatatgtgtaattacgaatccaagcaagttcttgaaacaggaat
taagttggccaccatgaaatatggcgaaatcgaattcatgttttcactttcttacatagaaagtttgcttttactcaatt
aa
back to top
>FJ362525.1-SFB.m11125
atggcattcatactacgtaagaaagaaatcttaatcaacatcctagcaaaactacctgcaaaatccctagttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcaagttttgttagcacaaaccttcataggaatgtcacaaaac
atgcccaagtatatctactctgcctccaccacccagattttgaacgtctggtcaaccctgatgacccttatgttaaaaaa
gaatttcaatggtctcttttttccagtgaaacatttgaggagtgctacaagttaagccatcccttagggagcacggaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaattccgatagtcctatacacatat
ggaacccatcggttaggaaatttaggacccctccagtcaccaacattaacattaaatttagctgttttgctctacaattc
gggttccaccccggggttaatgactacaaggctgtgaggatgatgcgtaccaacaaaggtgctttggcagttgaggttta
tagtctcagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagggta
cattttttaacggagtagcataccattttattcagaagggtcccatattcagcattatgtcattcgattcaggcagtgaa
gaattcgaagaattcatagcaccagatgccatttgcagttcgctggagttatatattgacgtttacaaggaacaaatttg
cttgcttcttggctctcatccttgtgaggaggaggacatggacaaaattgacttatgggttttgcaagagaaacggtgga
aacaattgtgccctttcatttatccttcggatgattattatcgtacaataggggttagtatagacaataaactcttaatg
ctaggaagagatgacattaggggcatagcagatctgaatttgtgtgattacgaatccaagcaagttcttgaaacaggaat
taagttgggcaccatgaaatatggcgaaatcgaattcttgttttcattttcgtacatagaaagtttggttttactcaata
attga
back to top
>FJ362524.1-SFB.m11119
atggcattcatacgacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttat
gtgtacatgcaagtcatggagtaatttgattagcagctcgagttttgtcagcacacaccttgataggaatgtcacaaaac
atgctcatgtctatttactctgcctccaccacccaaattttgaatgtcacgtcgaccccgatgacccatatttagaagga
gaagttcaatggtctcttttttccaagggaacatttgagcagtgctccaagttaagccatcccttagggagcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcagatgagatattgaacttcgatagtcctatacacatat
ggaacccatcggttaggaaacttaggacccctacaatcagcaccaacatcactaaatttggctatattgctcttcaattc
ggcttccacccaggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaagatgccttcagtgttgaggttta
tagtcttagaacagactcttggaagatgattgaagtaattcctccttggttaaaatgcacttggcagcatcatcagggca
cattttttaatggagtagcataccactttattgagaaaggccctatattcagcattatgtcattcgattcaggcagtgaa
gaattcgaagaattcatagcaccagatgccattttcagttcacgcgagttatgcatggacgtttacatggaacaaatttg
cttgctttttggatcttatggttgtgaggaggacggcatggacaaaattgacttatgggttctgcacgaaaaacggtgga
aacaattgtgtccgtttattcgtttcgatgatcgttatgttacaatcgggattggtatcgataatgaactattaatgcaa
agaagagatttcgataatggcggagcagatctgtgtttgtgtacatccaagcaagtccttgaaactggaattaagttggc
catcatgacatatggggaaatcgagttcttgttttcaattatttacatggaaagtttggttttactcgataattattaa
back to top
>EU310402.2-SFB.m11040
cttgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcatag
gaatgtcagaaaacatgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacc
catatgttgaacaagaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtca
gggagcacagaacattatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagcc
atgttgctctgcaattcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgcc
ttggcggttgaggtttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttg
gcagcatcataagggtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcat
ttgattcaggcagtgaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtt
tacaaggaacaaatttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttct
gcaagaaaaacggtggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatag
ataataaactcctaatgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagcca
actcaacaagttctagaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttctta
back to top
>EU293149.1-SFB.m1812
cggtttctgtgtacgtgcaagtcatgtagtgatttgattggcagctcgagttttgtaagcatacaccttaacaggaacgt
cacaaaacatgcccatgtctatctactctgcctccaccacccaaattttgaacgtctggccgaccctgatgacccatatg
ttaaacaagaatttcactggtctctgttttcgaatgaaacatttgaggagtgctccaagttaagccatcccttggggagc
acagaacattatggggtatatggttcaagcaatggtttagtttgcatttcagatgagattttgaatttcgatagtcctat
acacatatggaacccatcggttaggaaacttaggaccactccaatgagcaccaatattaacgttaaatttagccatgttg
ctctccaattcgggttccaccctggggttaatgactacaaggctatgaggatgatgcgtaccaacaaaggtgctttggca
attgaggtttatagtctccgaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagca
tcacaggggtacaatttttaatggagtagcataccacatcattcagaaaggtcctctattcagcattatgtccttcgatt
taggcagtgaagaattcgaagaattcatagcaccagatgccatttgccgttcactggggttagggattgacgtttacaag
gaacaaatttgcttgctttttagattttatggttgtgaggaggaggacacggacaaatttgacttatgggttctgcaaga
aaaacgatggaa
back to top
>FJ887788.1-SFB.m1506
cctatacacatatggaacccctcggttaggaaatttagaacccttccaatgagcaccaaccacaacgttaaattccgcta
cattgctctccaattcgggttccaccctggggttaacgactacaaggttgtaaggatgttgtgcgtccacaaagacaatg
cttttgcggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcact
tggcagaaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgtc
attcgattcaggcagcgaaaaattcaaagagttcatagcaccggatgccattagctgttggtcacggctgtatattgagg
tttacaaggatcaaatttgcttgctttattatttgagactgtttcattgtgaggaagaaggcatgtcacaaattgagttt
tgggttctgcaagaaaaacgatggaa
back to top
>FJ887787.1-SFB.m1826
attcgatttctgtttacgtgcaagtcatggatggatttgattggcagctcgagttttgttagcacacaccttcataggaa
tgtcacaaaacatgcccatgtctctctactctgcctccaccaccaaagttttgaatgtcaggttgaccctgatgacccat
atgttggacaagaacttcaatggtctcttttttgcgacgaaacatttgtgctctgctccaagttaagccatcccttaggg
agcacagaacaatactatgggatatatggttcaagcaatggtttagtttgcatttcggacgagatattgaattttgatag
tcctatatacatatggaacccatcggtcaggaaacttaggacccctccactgagcaccaacattaacattaaatttagcc
atgttgctctccaattcgggttccaccctggggttaacgactacaaggttgtaaggatgttgtgcgtccacaaagacaat
gcttttgcggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcac
ttggcagaaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgt
cattcgattcaggcagcgaaaaattcaaagagttcatagcaccggatgccattagctgttggtcacggctgtatattgag
gtttacaaggatcaaatttgcttgctttattatttgagactgtttcattgtgaggaagaaggcatgtcacaaattgagtt
ttgggttctgcaagaaaaacgatgga
back to top
>FJ887786.1-SFB.m1826
attcgatttctgtttacgtgcaagtcatggatggatttgattggcagctcgagttttgttagcacacaccttcataggaa
tgtcacaaaacatgcccatgtctctctactctgcctccaccaccaaagttttgaatgtcaggttgaccctgatgacccat
atgttggacaagaacttcaatggtctcttttttgcgacgaaacatttgtgctctgctccaagttaagccatcccttaggg
agcacagaacaatactatgggatatatggttcaagcaatggtttagtttgcatttcggacgagatattgaattttgatag
tcctatatacatatggaacccatcggtcaggaaacttaggacccctccactgagcaccaacattaacattaaatttagcc
atgttgctctccaattcgggttccaccctggggttaacgactacaaggttgtaaggatgttgtgcgtccacaaagacaat
gcttttgcggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcac
ttggcagaaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgt
cattcgattcaggcagcgaaaaattcaaagagttcatagcaccggatgccattagctgttggtcacggctgtatattgag
gtttacaaggatcaaatttgcttgctttattatttgagactgtttcattgtgaggaagaaggcatgtcacaaattgagtt
ttgggttctgcaagaaaaacgatgga
back to top
>FJ514940.1-SFB.m11128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaactttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttatatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagtacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaactc
ataatggcaagaaaagatttcagtaagggcggagtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcatgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>FJ514939.1-SFB.m11128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaactttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttacatttgaagagagctccaagctaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcgtcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggacattatagttgtgaggaggatggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaaccc
ataatggcaagaaaagatttcagtaagggcggagtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcatgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>FJ514938.1-SFB.m11128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaattttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttacatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgatccaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaactc
ataatggcaagaaaagatttcagtaagggcggagtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcgtgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>FJ514937.1-SFB.m11125
atggcattcatactacgtaagaaagaaatcttgatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcgtggagtgattttattggcagccagagttttgttagcacacaccttcataggaatgtcactggac
atgcccatgcctatctactttgcctccaccacccaaattttgaatgtcaaagggacgatgatgacccatatgttaaagaa
gaactccagtggtcacttttttccaatgaaacatttaagcagtgcttcaagttaaaccatcctttagaaaatacagagca
ttataggatatatggttcaagcagtggtttagtttgcatttcggatgtgatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggactcttccaatgagcaccaacattaaccttaagtttgcctatgttgctctccaa
ttcgggttccacccgggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgccttggcggttgaggt
ttttagtcttggaacagactcttggaagatgattgaaggaattcctccttggttaaaatgcacttggaaacatcataacg
gtacattttttaatggagtagcatatcacataattgagaaaggccctatattcagcattatgtcattcgattcaggcagc
gaagaactcgaagaattcatagcaccagatgccatttgcagtccatgtgagttatggattgacgtttacaacgaacaaat
ttgcttgcttcttgaattgtatccttgtgcggaagagggtatggacaaaattgacttatggattctgcaagaaaaacggt
ggaaaccattgtgtccgtttatttatcctttggatcattattattgtacaattgggattagtatagataataaactctta
atgattagaaaagatgacatgaagggcatagcagacctgcatgtgtgtgattacggatccaagaaaagtcttaagacagg
aattaagttagccaatatgaaatatggcgaaatcgaatttttgttttcaatttcatacgtagaaagtttgcttttactca
attaa
back to top
>FJ514936.1-SFB.m11122
atggcattcatactacgtaagaaagaaatcttaatagacatcctggtgagactacctgcaaaatccctggttcggtttct
gtgcacatgcaagtcatggagtgatttgattggcagctccagtttagttagcacacaccttcataggaatgtcacaaagc
atgaccatgtctatttactttgtctccaccactcaaattttgaacttcaggctgaccctgatgacccatatgttaaacaa
gaatttcaatggtcccttttttccaatcaaacatttgagcagtgctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggctcaagcaatggtctagtttgtatttcggatgagatattgaatttcgatactcctatacacatat
ggaacccatcggttaggaaacttagggcccttccaatcagcaccaacattaacattaaatttagtcatgttgctctccaa
ttcgggtttcaccccgtggttaatgactacaaggctgtaaggatgatgcgcaccaacaaaaatcccttggcggttgaggt
ttatagtcttagaacagactcttggaaaatgattgaagtacttccgccttggttaaaatgcacttggaaacatcataagg
gtacatttcttaatggagtagcataccacatgattcagaaaggtcctatattcagcattgtgtcgtttgattcaggcagt
gaagaattccaagaattcatagcaccagatgccatttgcaatccatgtgagctggtacgtattgacgtttacaaggaaca
aatttgcttgctttgtagcttgtatccttctgaggatggcatgggaaaaaatgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctcttgattgcgatggtacaatagggattagtatagataatgaactcttaatg
gaaaaaagagatttcgataggggcatagcaaatgtgcatttgtgtaattaccaatccaagcaagttcttgaaacaggaat
tgagttggccgtcatgaaatatggcgaaatggagttgctgtttgcaattacttacatagaaagtttgcttttactcaatt
aa
back to top
>FJ514935.1-SFB.m11128
atggcattcatactacgtaagaaagaaatcaaaatcgacatcttagtaagactacctgcaaaatcccttgttcggtttat
gtctacatgcaagtcatggagtgatttgatcggcagctcgagtcttgtcagcacacaccttgataggaatgtcactaaac
atgcccatgtctatttactttgcctcctccacccaaatgttgaacgtcaggctgaccctgatgacccctatgttaaacaa
gaatttcaatggtcattgttttccaatgaaacatttgaggagtgctccaagttaagccatcccttaaggagcacagaata
ttatgtgatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcagttaagaaatttaggacctctccaatgagcaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcacaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatctcaatg
gtacaatttttaatggagttgcataccacatcattcagaaaggttctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgtagttcattggggttatgcatccgggtttacaaggaacaaat
ctgcttgctttttgggttttatggttgtgaggaggaggatatggacaaaattgacttctgggttctacaagaaaaaaggt
ggacacaattgtgtacttttatttattatccttcggattattctcatcgtataatcgggattagtatagataatgaaatc
ttaatggaaagaagacatttccttaggggcataggatatctgcatttgtgtaattacgaatccaagcaagttcttgaaac
aggaattgagttggccgttctgaaatatggcgaaatcgaattctcttatgcaattacttacatagaaagtttgcttttac
tcaattaa
back to top
>FJ231204.1-SFB.m11128
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagatttgttggcacacaccttcataggaatgtcacgggac
atgcccaggcctatctcctttgcctccaccacccaaattttgaatgtcaaagggatgatgatgacccatattttaaagaa
gaactccaatggtcactgttttccaatgttacatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ctatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatgttgctctccaa
ttcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttggcggttgagat
ttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatcagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttacaaggagcaaat
ttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatgatcccttggatgatttctatcagataatcgggattagtactgacaataaactc
ataatggcaagaaaagatttcagtaagggcggcgtagaactgcaattggggaattacgaatccaaacaagttcttgaaac
agggattaagttggccatcatgagatatggcgaaagcgaattcttgtttgcaatgacttacgtagaaagtttgcttttac
tcaattaa
back to top
>EU909685.1-SFB.m11131
atggcattcatacgacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttgt
ttgtacatgcaagtcatggagtgatttgattggtagctccagttttgttagcatacacgttaacaggaatgtcacaaaac
atgcccatgtctatttactctgcctccaccacccaaattttgaacgtcagaatgacaatgatgacccatatgatatagaa
gaacttcaatggtcgcttttttccaatgaaacgtttcagcagttctccaagttgagccatcccttagaaagcacagagca
gtataggatatatggtgcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccgtctgttaggaaatttaggacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcggtttccaccccggggttaatgactacaaggctgtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggt
ttacagtcttaaaacatactgttggaagatgattgaagcaattcctccttggttaaaatgcacttggaagcatcataagg
gtacattttttaatggggtagcataccacatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcaat
gaagaattcgaagaattcatagcaccagatgacatttgcagttcatgggggttatgcatcgacatttacaaggaacgaat
ttgcttgctttttgacttttatccttgtgaggaggagtgcatggaaaaatttgacttttgggttctgcaagaaaaacggt
ggaaacaattgcgtccttttatttattcttcggattattgttttcgtacaatcgggattagtatagataatgaactctta
ttggcaagaagaggtttcgatcagggcatagcagatctgtgtttgtgtaattacgaatccaagcaagttcttgaaacaga
tataaagttggccgtcatgagatatggtgaaatcgaatccttgtttgcaattaattacgtagaaagtttggttttattca
ataatcattaa
back to top
>AM711127.1-SFB.m11107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>AM711126.1-SFB.m11107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>AM711125.1-SFB.m11107
atggcattcacactacgtaagaaagaaatcatgatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcagaaaac
atgcacatgtctatctcctttgtctccaccacccaaattttgaacgaaaagacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttcgaaagaaacattagaggaatgctctaagttaagccatccgtcagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaatttaggacacctccggtgagcaccaacattaacatgaaatttagccatgttgctctgcaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggt
ttatagtctcagaacagactcttggaagatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtatattttttaatggagtagcataccacatcattgagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagcaccagatactatttgcacttcatgggatttatgtattgacgtttacaaggaacaaat
ttgctgtcttcttaagttttattcttgtgaggaggaagacatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttgtttatcctttcaattattattatggtacaatcgggattagtatagataataaactccta
atgctaaaaagagatgacattaggggtcaaccagatctgcatttgtgtgattacgactccaagccaactcaacaagttct
agaaacaggaattaaattggccaccatgaaatatggcgaaatcgaatttttgttttcactttcttac
back to top
>EU310403.1-SFB.m1814
gttcgatttctgtttacatgcaagtcgtggaatgatttgattggcagctcgagttttgtcagcacacaccttaataggaa
tgtcacaaagcatgcccatgtctgtatactttgcctccaccacccaaattttgaacgcctgatcaaccgcgatgacccat
attttaaaaaggaatttcaatggtctcttttttccaatgaaacatttgagcagtgctacaagttaagccatcccttaggg
agcacagaacattattggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcc
tatacacatatggaacccatcggttaggaaacttaaaaccactccaatgagcaccaacattaatatgaaatttagcattg
tttctctccagtttgggttccaccccggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaaggtgctgtg
gcaattgaggtttatagttttagaacagaatcttggaagatgattgaagcaattcttccttggctaaaatgcacttggca
gcatcataaggggatttttttaaatggagcagcatacgacatcattgagaaaggtcctatattcagcgttatgtcattcg
attcaggcagtgaagaattcaaagaattcttagtaccagatgccatttgcgcttcatggggattatgcatcgacgtttac
aagggacaaatttgcttgctttttgattgttatccttgtgaggaggagggcatggagaaaatcgacttatgggttctgca
agaaaaacgatgga
back to top
>EU293148.1-SFB.m1816
gttcgatttctgtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttggcacacaccttcataggaa
tgtcacgggacatgcccaggcctatctcctttgcctccaccacccaaattttgaatgtcaaagggatgatgatgacccat
attttaaagaagaactccaatggtcactgttttccaatgttacatttgaagagagctccaagttaagccatcccttaggg
agcacagaacattatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagataatgaatttcgatagtcc
tatacacatatggaacccatcggttaagaaacttagaaccactccaatcagcaccagcattaacattaaatttagccatg
ttgctctccaattcggtttccactccggggttaatgactacagggctgtaaggatgttgcgtacaaaccaaaatgccttg
gcggttgagatttatagtctcagaacagactcttggacgatgattgaagcaattcctccttggttaaaatgcacttggca
gcatcatcagggtacattttttaatggagtagcataccacatcattgagaaaggtcctacattcagtgttatatcattcg
attcaggcagtgaagaatttgaagaattcatagcaccagatgccatttgcagtttatggaggttatgcatccacgtttac
aaggagcaaatttgcttgctttttggatattatagttgtgaggaggagggcatggaaaacattgacttatgggttctgca
agaaaaacggtggaaa
back to top
>EU293147.1-SFB.m1815
cgatttctgtgtacatgcaagtcatggagtgattttattggcagctcgggttttgttagcacacaccttgataggaatgt
cacaaaacatgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatg
ttaaaaaagaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaac
acagaacattatgggatatatggttcgagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctat
acacatatggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgttt
ctcttcaatttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcg
gttgaggtttatagtcttagaacagactcttggaagatgattcaagaaattcctccttggttaaaatgcacttggcagca
tcataagggaacattttctaatggagtagcataccacatcatcgagaagggtcctataatcagcattatgtcattcaatt
caggcagtgaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcgaggtctacaag
gaacaaatttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagg
aaaacggtggaaaca
back to top
>AM746960.1-SFB.m1989
gacatcctagtaagactacctgcaaaatccctggttcggtttctgtgcacatgcaagtcatggagtgatttgattggcag
ctccagtttagttagcacacaccttcataggaatgtcacaaagcatgaccatgtctatttactttgtctccaccactcaa
attttgaacttcaggctgaccctgatgacccatatgttaaacaagaatttcaatggtcccttttttccaatcaaacattt
gagcagtgctccaagttaagccatcccttagggagcacagaacattatgtgatatatggctcaagcaatggtctagtttg
tatttcggatgagatattgaatttcgatactcctatacacatatggaacccatcggttaggaaacttagggcccttccaa
tcagcaccaacattaacattaaatttagtcatgttgctctccaattcgggtttcaccccgtggttaatgactacaaggct
gtaaggatgatgcgcaccaacaaaaatcccttggcggttgaggtttatagtcttagaacagactcttggaaaatgattga
agtacttccgccttggttaaaatgcacttggaaacatcataagggtacatttcttaatggagtagcataccacatgattc
agaaaggtcctatattcagcattgtgtcgtttgattcaggcagtgaagaattccaagaattcatagcaccagatgccatt
tgcaatccatgtgagctggtacgtattgacgtttacaaggaacaaatttgcttgctttgtagcttgtatccttctgagga
tggcatgggaaaaaatgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttgtttatcctcttgatt
gcgatggtacaatagggattagtatagataatgaactcttaatggaaaaaagagatttcgataggggcatagcaaatgtg
cacttgtgtaattacgaatccaagcaagt
back to top
>AM746959.1-SFB.m1989
gacatcctagtaagacttccagcaaaatccctccttcggtttctgtgtacatgcaagtcatggagtgatttgattggcag
ctcgagttttgttagcatgcaccttcataggaatgtcagaaaacatgcccatgtgtatctcctctgcctccaccacccaa
atgttagacgtcaggtggaccctgatgacccatatgttaaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtacttcaagttaagccatcccttggggagcccagaatattttgtgatatatggttcaagcaacggtttagtttg
catttcggatgagatattgaatttcgatagcccaatacacatatggaacccatcggttaggaaatttaggaccattccaa
tgagcaccaacatcaacattaaatttagctatgttgctctccaattcgggttccacccccggattaatgactacaaggct
gtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatctgaagggtacattttttggtggagtatcataccacatcattc
agaaaggtcctatattcagcattgtgtccttcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatt
tgccgtccatttgcgttatgtattgacgtctacaaggagcaaatttgtttgctttttagattttattcttgtgcggatga
ggacatggcaaaaaatgacttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcttgata
gctatggtacaatcgggattagtatagataatgaactcttattggaaagaagagattttattaggggcataggagatcta
tgtttgtggaattatgaatccaagcaggt
back to top
>AM746958.1-SFB.m1987
gacatcctagcaagacttactgcaaaatccctcgttcggtttgtttgtacatgcaagtcatggagtgatttgattggtag
ctccagttttgttagcatacacgttaacaggaatgtcacaaaacatgcccatgtctatttactctgcctccaccacccaa
attttgaacgtcagaatgacaatgatgacccatatgatatagaagaacttcaatggtcgcttttttccaatgaaacgttt
cagcagttctccaagttgagccatcccttagaaagcacagagcagtataggatatatggtgcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaacccgtctgttaggaaatttaggacccctccaa
tgagcaccaacattaacatgaaattttcccatgttgctctccaattcggtttccaccccggggttaatgactacaaggct
gtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggtttacagtcttaaaacatactgttggaagatgattga
agcaattcctccttggttaaaatgcacttggaagcatcataagggtacattttttaatggagtagcataccacatcattg
agaaaggtcctatatgcagcattatgtcattcgattcaggcaatgaagaattcgaagaattcatagcaccagatgacatt
tgcagttcatgggggttatgcatcgacatttacaaggaacgaatttgcttgctttttgacttttatccttgtgaggagga
gtgcatggaaaaatttgacttttgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttattcttcggatt
attgttttcgtacaatcgggattagtatagataatgaactcttattggcaagaagaggtttcgatcagggcatagcagat
ctgtgtttgtgtaattacgaatccaaa
back to top
>EF061758.1-SFB.m11092
atgacatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgggttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcgagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagaaattcctccttggttaaaatgcacttggcagcatcataagg
gaacattttctaatggagtagcataccacatcatcgagaagggtcctataatcagcattatgtcattcaattcaggcagt
gaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcgaggtctacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaaggaaaacggt
ggaaacaattgtgccctttcatttattcttcagattattgttatcgtacaatcgggattagtatagatgatgaactctta
atggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaatt
back to top
>DQ983371.1-SFB.m213
ttttgctcaataa
back to top