SFB, SFB (gene) Prunus kansuensis

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus kansuensis
Synonym S locus-linked F-box protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAB731115.1-SFBPrunus kansuensisgene
SFBAB731114.1-SFBPrunus kansuensisgene
SFBAB731113.1-SFBPrunus kansuensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAB731115.1-SFB.m1Prunus kansuensismRNA
SFBAB731114.1-SFB.m1Prunus kansuensismRNA
SFBAB731113.1-SFB.m1Prunus kansuensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus kansuensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB731115.1-SFB N/A AB731115.1
gene parsed from NCBI nr database AB731114.1-SFB N/A AB731114.1
gene parsed from NCBI nr database AB731113.1-SFB scaffold_6:26422484..26423281
AB731113.1
mRNA parsed from NCBI nr database AB731115.1-SFB.m1 N/A AB731115.1
mRNA parsed from NCBI nr database AB731114.1-SFB.m1 N/A AB731114.1
mRNA parsed from NCBI nr database AB731113.1-SFB.m1 scaffold_6:26422484..26423281
AB731113.1

Sequence(s):
>AB731115.1-SFB1038
cctagcaaggctacctgcaaaatccctcgttcggtttatttgtacatgcaagtcatggagtgatttgattggcagctcga
gttttgtcagcacacaccttaataggaatgtcacaaaacatgcccatgtccatctcctttgcctccaccacccaaatttt
gaatgcgtggtcgaccgtgatgacccatatttagaagaagaagttcaatggtctcttttttccaaagaaacatttgagca
gtgctccaagttaagccatcccttagggagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcattt
cagatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaacttaggacgcttccaatgagc
accaacattaacattaaatttagctgtgtttctctccaattcgggttccaccccggggttaatgattacaaggctgtgag
gatgatgcgtaccaacaaaggtgctttggcagttgaggtttatagtcttagaacagaatcttggaagatgactgaaacaa
ttcctccttggttaaaatgcacttggcagcatcataagggaacgttttttaatggagtggcatacaacatcattgaaaaa
ggtcctatagtcagcattatgtcattcgattcagatagtgaagtgttcgaagaattcatagcaccagatgccatttgccg
tccatttgcgttatgtattgacgtttacaaggaacaaatttgcttgcttttcagattttattattgtgaggaggaggata
tgggaaaaaatgacttgtgggttctgcaagacaaacggtggaaacaattgtgtccttttatttaccctgttggtacgtat
ggtacaatcgggattagtacagataatgaactcataatggaaagaagagatttccgaaggggcgtaggagatctgtgttt
atgtaattacgaatccaagcaagtttttgaaacaggaattgagttgggcctcattaaatatggcgaaatcgaattctt
back to top
>AB731114.1-SFB791
catggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaaacatgcccatgtctgt
ctactctgcctccaccacccaaatgttagacgccagttcaatcctgatgacccatatgttaaacaagaatgccaatggtc
tcttttttccattgaaacatttgaggagtgctccaagttaacccatcctttaaggagcacagaacattatggggtatatg
gttcaatcaatggtttaatttgcatttcggatgagatattgaatttcgatagtcctatatacatatggaacccatcggtt
aggaaatttaggacccttccaatgagcaccaacattaacattaaatttagctatgttgatctccaattcggtttccaccc
ccggtttaatgactacaaggctgtaaggatgatgcgtacgaacaaaagtgctttcacagttgaggtttatagtcttagaa
cagattcgtggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatacgggtacatttttcaat
ggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcaattcaggcactgaagaattccaaga
attcatagcaccagatgccatttgcgctccatggggattatgtattgacgtttacaagggacaaatttgcttgcttttta
tgtgctttggttgtgaggaggagggcatggacaaagttgacttatgggttctgcaaggaaaacgatggaaa
back to top
>AB731113.1-SFB792
tcatggagtgatttgattggcggctcgagttttgttagcgcacaccttaataggaatgccacaaaacatgcccatgtctg
tctactttgtctccaccacccaaattttgaacgcctggtcaaccgtgatgacccatattttaaaaaagaatttcaatggt
ctcttttttccaatgaaacatttgaggagttctccaagttaagccatcccgtagggagcacagaacattatgtgatatat
ggctcaagcaatggtttagtttgcatatccgatgagatactgaatttcgatagtcctatatacatatggaacccatcagt
taggaaacttaggacgcttccaatgagcaccaacattaacattaaatttagctgtgtttctctccaattcgggttccacc
ccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcaga
acagactcttggaagatgattggagcaattcctccgtggttaaaatgcacttggcagcattataagggtacattttttga
cggagtagcatatcacgtcattcagaaaggtcctatattcagcattatgtccttcgattcaggcaatgaagaattcgaag
aatttatagcaccagatgccatttgcggtacatttgggttatgcatcgacatttacaaggaacaaatttgtttgctcttt
agatgttatggttgtgaggaggagggcatgaacaaagttgacttatgggttctgcaagaaaaacggtggaaa
back to top
>AB731115.1-SFB.m11038
cctagcaaggctacctgcaaaatccctcgttcggtttatttgtacatgcaagtcatggagtgatttgattggcagctcga
gttttgtcagcacacaccttaataggaatgtcacaaaacatgcccatgtccatctcctttgcctccaccacccaaatttt
gaatgcgtggtcgaccgtgatgacccatatttagaagaagaagttcaatggtctcttttttccaaagaaacatttgagca
gtgctccaagttaagccatcccttagggagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcattt
cagatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaacttaggacgcttccaatgagc
accaacattaacattaaatttagctgtgtttctctccaattcgggttccaccccggggttaatgattacaaggctgtgag
gatgatgcgtaccaacaaaggtgctttggcagttgaggtttatagtcttagaacagaatcttggaagatgactgaaacaa
ttcctccttggttaaaatgcacttggcagcatcataagggaacgttttttaatggagtggcatacaacatcattgaaaaa
ggtcctatagtcagcattatgtcattcgattcagatagtgaagtgttcgaagaattcatagcaccagatgccatttgccg
tccatttgcgttatgtattgacgtttacaaggaacaaatttgcttgcttttcagattttattattgtgaggaggaggata
tgggaaaaaatgacttgtgggttctgcaagacaaacggtggaaacaattgtgtccttttatttaccctgttggtacgtat
ggtacaatcgggattagtacagataatgaactcataatggaaagaagagatttccgaaggggcgtaggagatctgtgttt
atgtaattacgaatccaagcaagtttttgaaacaggaattgagttgggcctcattaaatatggcgaaatcgaattctt
back to top
>AB731114.1-SFB.m1791
catggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaaacatgcccatgtctgt
ctactctgcctccaccacccaaatgttagacgccagttcaatcctgatgacccatatgttaaacaagaatgccaatggtc
tcttttttccattgaaacatttgaggagtgctccaagttaacccatcctttaaggagcacagaacattatggggtatatg
gttcaatcaatggtttaatttgcatttcggatgagatattgaatttcgatagtcctatatacatatggaacccatcggtt
aggaaatttaggacccttccaatgagcaccaacattaacattaaatttagctatgttgatctccaattcggtttccaccc
ccggtttaatgactacaaggctgtaaggatgatgcgtacgaacaaaagtgctttcacagttgaggtttatagtcttagaa
cagattcgtggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcatacgggtacatttttcaat
ggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcaattcaggcactgaagaattccaaga
attcatagcaccagatgccatttgcgctccatggggattatgtattgacgtttacaagggacaaatttgcttgcttttta
tgtgctttggttgtgaggaggagggcatggacaaagttgacttatgggttctgcaaggaaaacgatggaaa
back to top
>AB731113.1-SFB.m1792
tcatggagtgatttgattggcggctcgagttttgttagcgcacaccttaataggaatgccacaaaacatgcccatgtctg
tctactttgtctccaccacccaaattttgaacgcctggtcaaccgtgatgacccatattttaaaaaagaatttcaatggt
ctcttttttccaatgaaacatttgaggagttctccaagttaagccatcccgtagggagcacagaacattatgtgatatat
ggctcaagcaatggtttagtttgcatatccgatgagatactgaatttcgatagtcctatatacatatggaacccatcagt
taggaaacttaggacgcttccaatgagcaccaacattaacattaaatttagctgtgtttctctccaattcgggttccacc
ccggggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcaga
acagactcttggaagatgattggagcaattcctccgtggttaaaatgcacttggcagcattataagggtacattttttga
cggagtagcatatcacgtcattcagaaaggtcctatattcagcattatgtccttcgattcaggcaatgaagaattcgaag
aatttatagcaccagatgccatttgcggtacatttgggttatgcatcgacatttacaaggaacaaatttgtttgctcttt
agatgttatggttgtgaggaggagggcatgaacaaagttgacttatgggttctgcaagaaaaacggtggaaa
back to top