SFB, SFB (gene) Prunus salicina

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus salicina
Synonym S-locus-F-box protein b
S-locus-F-box protein h
S-locus-F-box protein f
S-locus-F-box protein c
S-locus-F-box protein e
S-locus-F-box
F-box protein SFB
S haplotype-specific F-box protein
S-locus-F-box protein
S-haplotype-specific F-box protein
Description pollen determinant in self-incompatibility reaction
Comment encodes for the pollen determinant in the GSI system; F-box protein family member
F-box; Sh-haplotype
F-box; Se-haplotype
F-box; Sc-haplotype
F-box; Sb-haplotype
PsSFB-h; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-10; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-f; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-b; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-a; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-e; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-7; role in gametophytic self-incompatibility as a pollen S-determinant
PsSFB-c; role in gametophytic self-incompatibility as a pollen S-determinant
SFBk
Sg SFB
Sf-SFB
F-box protein; PsSFB
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBKJ396620.1-SFBPrunus salicinagene
SFBKJ396619.1-SFBPrunus salicinagene
SFBKJ396618.1-SFBPrunus salicinagene
SFBKJ396617.1-SFBPrunus salicinagene
SFBKJ396616.1-SFBPrunus salicinagene
SFBKJ396615.1-SFBPrunus salicinagene
SFBKJ396614.1-SFBPrunus salicinagene
SFBKJ396613.1-SFBPrunus salicinagene
SFBKJ396612.1-SFBPrunus salicinagene
SFBKJ396611.1-SFBPrunus salicinagene
SFBKJ396610.1-SFBPrunus salicinagene
SFBKJ396609.1-SFBPrunus salicinagene
SFBKJ396608.1-SFBPrunus salicinagene
SFBKJ396607.1-SFBPrunus salicinagene
SFBKJ396606.1-SFBPrunus salicinagene
SFBKJ396605.1-SFBPrunus salicinagene
SFBDQ646491.1-SFBPrunus salicinagene
SFBDQ646490.1-SFBPrunus salicinagene
SFBDQ646489.1-SFBPrunus salicinagene
SFBDQ646488.1-SFBPrunus salicinagene
SFBDQ849118.1-SFBPrunus salicinagene
SFBDQ849090.1-SFBPrunus salicinagene
SFBDQ849089.1-SFBPrunus salicinagene
SFBDQ849088.1-SFBPrunus salicinagene
SFBDQ849087.1-SFBPrunus salicinagene
SFBDQ849086.1-SFBPrunus salicinagene
SFBDQ849085.1-SFBPrunus salicinagene
SFBDQ849084.1-SFBPrunus salicinagene
SFBAM746963.1-SFBPrunus salicinagene
SFBAM746962.1-SFBPrunus salicinagene
SFBAM746961.1-SFBPrunus salicinagene
SFBDQ992485.1-SFBPrunus salicinagene
SFBDQ989579.1-SFBPrunus salicinagene
SFBDQ989578.1-SFBPrunus salicinagene
SFBEF490571.1-SFBPrunus salicinagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBKJ396620.1-SFB.m1Prunus salicinamRNA
SFBKJ396619.1-SFB.m1Prunus salicinamRNA
SFBKJ396618.1-SFB.m1Prunus salicinamRNA
SFBKJ396617.1-SFB.m1Prunus salicinamRNA
SFBKJ396616.1-SFB.m1Prunus salicinamRNA
SFBKJ396615.1-SFB.m1Prunus salicinamRNA
SFBKJ396614.1-SFB.m1Prunus salicinamRNA
SFBKJ396613.1-SFB.m1Prunus salicinamRNA
SFBKJ396612.1-SFB.m1Prunus salicinamRNA
SFBKJ396611.1-SFB.m1Prunus salicinamRNA
SFBKJ396610.1-SFB.m1Prunus salicinamRNA
SFBKJ396609.1-SFB.m1Prunus salicinamRNA
SFBKJ396608.1-SFB.m1Prunus salicinamRNA
SFBKJ396607.1-SFB.m1Prunus salicinamRNA
SFBKJ396606.1-SFB.m1Prunus salicinamRNA
SFBKJ396605.1-SFB.m1Prunus salicinamRNA
SFBDQ646491.1-SFB.m1Prunus salicinamRNA
SFBDQ646490.1-SFB.m1Prunus salicinamRNA
SFBDQ646489.1-SFB.m1Prunus salicinamRNA
SFBDQ646488.1-SFB.m1Prunus salicinamRNA
SFBDQ849118.1-SFB.m1Prunus salicinamRNA
SFBDQ849090.1-SFB.m1Prunus salicinamRNA
SFBDQ849089.1-SFB.m1Prunus salicinamRNA
SFBDQ849088.1-SFB.m1Prunus salicinamRNA
SFBDQ849087.1-SFB.m1Prunus salicinamRNA
SFBDQ849086.1-SFB.m1Prunus salicinamRNA
SFBDQ849085.1-SFB.m1Prunus salicinamRNA
SFBDQ849084.1-SFB.m1Prunus salicinamRNA
SFBAM746963.1-SFB.m1Prunus salicinamRNA
SFBAM746962.1-SFB.m1Prunus salicinamRNA
SFBAM746961.1-SFB.m1Prunus salicinamRNA
SFBDQ992485.1-SFB.m1Prunus salicinamRNA
SFBDQ989579.1-SFB.m1Prunus salicinamRNA
SFBDQ989578.1-SFB.m1Prunus salicinamRNA
SFBEF490571.1-SFB.m1Prunus salicinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus salicinagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KJ396620.1-SFB N/A KJ396620.1
gene parsed from NCBI nr database KJ396619.1-SFB N/A KJ396619.1
gene parsed from NCBI nr database KJ396618.1-SFB N/A KJ396618.1
gene parsed from NCBI nr database KJ396617.1-SFB N/A KJ396617.1
gene parsed from NCBI nr database KJ396616.1-SFB N/A KJ396616.1
gene parsed from NCBI nr database KJ396615.1-SFB N/A KJ396615.1
gene parsed from NCBI nr database KJ396614.1-SFB N/A KJ396614.1
gene parsed from NCBI nr database KJ396613.1-SFB N/A KJ396613.1
gene parsed from NCBI nr database KJ396612.1-SFB N/A KJ396612.1
gene parsed from NCBI nr database KJ396611.1-SFB N/A KJ396611.1
gene parsed from NCBI nr database KJ396610.1-SFB N/A KJ396610.1
gene parsed from NCBI nr database KJ396609.1-SFB N/A KJ396609.1
gene parsed from NCBI nr database KJ396608.1-SFB N/A KJ396608.1
gene parsed from NCBI nr database KJ396607.1-SFB N/A KJ396607.1
gene parsed from NCBI nr database KJ396606.1-SFB N/A KJ396606.1
gene parsed from NCBI nr database KJ396605.1-SFB N/A KJ396605.1
gene parsed from NCBI nr database DQ646491.1-SFB N/A DQ646491.1
gene parsed from NCBI nr database DQ646490.1-SFB N/A DQ646490.1
gene parsed from NCBI nr database DQ646489.1-SFB N/A DQ646489.1
gene parsed from NCBI nr database DQ646488.1-SFB N/A DQ646488.1
gene parsed from NCBI nr database DQ849118.1-SFB N/A DQ849118.1
gene parsed from NCBI nr database DQ849090.1-SFB N/A DQ849090.1
gene parsed from NCBI nr database DQ849089.1-SFB N/A DQ849089.1
gene parsed from NCBI nr database DQ849088.1-SFB N/A DQ849088.1
gene parsed from NCBI nr database DQ849087.1-SFB scaffold_6:26422457..26423439
DQ849087.1
gene parsed from NCBI nr database DQ849086.1-SFB N/A DQ849086.1
gene parsed from NCBI nr database DQ849085.1-SFB N/A DQ849085.1
gene parsed from NCBI nr database DQ849084.1-SFB N/A DQ849084.1
gene parsed from NCBI nr database AM746963.1-SFB N/A AM746963.1
gene parsed from NCBI nr database AM746962.1-SFB N/A AM746962.1
gene parsed from NCBI nr database AM746961.1-SFB scaffold_6:26422427..26423414
AM746961.1
gene parsed from NCBI nr database DQ992485.1-SFB N/A DQ992485.1
gene parsed from NCBI nr database DQ989579.1-SFB N/A DQ989579.1
gene parsed from NCBI nr database DQ989578.1-SFB N/A DQ989578.1
gene parsed from NCBI nr database EF490571.1-SFB N/A EF490571.1
mRNA parsed from NCBI nr database KJ396620.1-SFB.m1 N/A KJ396620.1
mRNA parsed from NCBI nr database KJ396619.1-SFB.m1 N/A KJ396619.1
mRNA parsed from NCBI nr database KJ396618.1-SFB.m1 N/A KJ396618.1
mRNA parsed from NCBI nr database KJ396617.1-SFB.m1 N/A KJ396617.1
mRNA parsed from NCBI nr database KJ396616.1-SFB.m1 N/A KJ396616.1
mRNA parsed from NCBI nr database KJ396615.1-SFB.m1 N/A KJ396615.1
mRNA parsed from NCBI nr database KJ396614.1-SFB.m1 N/A KJ396614.1
mRNA parsed from NCBI nr database KJ396613.1-SFB.m1 N/A KJ396613.1
mRNA parsed from NCBI nr database KJ396612.1-SFB.m1 N/A KJ396612.1
mRNA parsed from NCBI nr database KJ396611.1-SFB.m1 N/A KJ396611.1
mRNA parsed from NCBI nr database KJ396610.1-SFB.m1 N/A KJ396610.1
mRNA parsed from NCBI nr database KJ396609.1-SFB.m1 N/A KJ396609.1
mRNA parsed from NCBI nr database KJ396608.1-SFB.m1 N/A KJ396608.1
mRNA parsed from NCBI nr database KJ396607.1-SFB.m1 N/A KJ396607.1
mRNA parsed from NCBI nr database KJ396606.1-SFB.m1 N/A KJ396606.1
mRNA parsed from NCBI nr database KJ396605.1-SFB.m1 N/A KJ396605.1
mRNA parsed from NCBI nr database DQ646491.1-SFB.m1 N/A DQ646491.1
mRNA parsed from NCBI nr database DQ646490.1-SFB.m1 N/A DQ646490.1
mRNA parsed from NCBI nr database DQ646489.1-SFB.m1 N/A DQ646489.1
mRNA parsed from NCBI nr database DQ646488.1-SFB.m1 N/A DQ646488.1
mRNA parsed from NCBI nr database DQ849118.1-SFB.m1 N/A DQ849118.1
mRNA parsed from NCBI nr database DQ849090.1-SFB.m1 N/A DQ849090.1
mRNA parsed from NCBI nr database DQ849089.1-SFB.m1 N/A DQ849089.1
mRNA parsed from NCBI nr database DQ849088.1-SFB.m1 N/A DQ849088.1
mRNA parsed from NCBI nr database DQ849087.1-SFB.m1 scaffold_6:26422457..26423439
DQ849087.1
mRNA parsed from NCBI nr database DQ849086.1-SFB.m1 N/A DQ849086.1
mRNA parsed from NCBI nr database DQ849085.1-SFB.m1 N/A DQ849085.1
mRNA parsed from NCBI nr database DQ849084.1-SFB.m1 N/A DQ849084.1
mRNA parsed from NCBI nr database AM746963.1-SFB.m1 N/A AM746963.1
mRNA parsed from NCBI nr database AM746962.1-SFB.m1 N/A AM746962.1
mRNA parsed from NCBI nr database AM746961.1-SFB.m1 scaffold_6:26422427..26423414
AM746961.1
mRNA parsed from NCBI nr database DQ992485.1-SFB.m1 N/A DQ992485.1
mRNA parsed from NCBI nr database DQ989579.1-SFB.m1 N/A DQ989579.1
mRNA parsed from NCBI nr database DQ989578.1-SFB.m1 N/A DQ989578.1
mRNA parsed from NCBI nr database EF490571.1-SFB.m1 N/A EF490571.1

Sequence(s):
>KJ396620.1-SFB1131
atggcattcaccctacgtaagaaagaaatcttaatcgacgtcctagtaagactacctgcaaaatccgtcgttcggtttct
ttgtacatgcaggtcatggagtggattgattggcagctccagttttgttagcatacaccttaaaagggatgtcacaaaac
acgcccatgtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttacaatgaaacgtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgccttggcagttgaagt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcattataagg
gtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtttacaatcaacaaat
ttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttctccaagaaaaacggt
ggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatagataataaactctta
atgcaaagaacagattacaatatgggcattgcagatctgcttttgtgtgattacgaatccaagcaagttcttgaaacaag
gattaagttggccctcgtgaaatatggcgaaatcgaatttgtgttttcaattacttacatagaaagtttggttttactca
ataattattaa
back to top
>KJ396619.1-SFB1125
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacccaccttcataagaaggtcacaaaac
tggcccaggtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccatatgatatagaa
caacttcaatggtcacttttttccactgaaacatttgagcagttcttcgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggccgtgagaatgatgcataccaacaaagatgtcttcgcggttgaggttta
tagtcttagaacaaattcttggaagatgattgaaacaattcctccttggttaagatgcacttggcagcaacatcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatattttcagcattatgtcattcgattcaggcagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttgtggatcgacgtttacaaggaacaaatttg
cttgctttctggatattatggttgtgaggaggagggcatggacaaaattgatttatgggttttgcaagaaaaacggtgga
aacaattacgtccttttacttatcctttggattattattattatcgtacaatggggattagtatagataataaactatta
tcgctaagaagaaatgacattagcggtatagcagatctgcacttgtgtgatttcgaatacaagcaagtactaacaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaagtttggttttactca
attag
back to top
>KJ396618.1-SFB1131
atggcattcaccctacgtaagaaagaaatcttaatcgacgtcctagtaagactacctgcaaaatccgtcgttcgatttct
ttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaaaaggaatgtcacaaaac
acgcccatgtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttccaatgaaacgtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttttaggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgccttggcagttgaagt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcattataagg
gtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtttacaatcaacaaat
ttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttcttccagaaaaacggt
ggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatagataataaactctta
atgcaaagaacagattacaatatgggcattgcagatctgcatttgtgtgattacgaatccaagcaagttcttgaaacaag
gattaagttggccctcgtgaaatatggcgaaatcgaatttgtgttttcaattacttacatagaaagtttggttttactca
ataattattaa
back to top
>KJ396617.1-SFB1086
atgatcctagtaagactacctgcaaaatccctcattcggtttctgtgcacatgcaagtcatggtgtgatttgattggcag
ctcaggttttattagaacacaccttaataggaatgtcagaaaacatgcccatgtctgtctactttgcctccaccacccaa
attttgaacgtctggtcgaccgtgatgacccatatgttaaaaaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtgctacaagttaagccatcccttagggagcacagaacattatgtgatatatggttcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaagacccctccaa
tcagcaacaacattaacattaaatttagttatgttgctctccaattcgggttccaccccggggttaatgactacaaggct
gtaaggatgctgcgtaccaacaaagatgcctttgcagttgaggtttatagtcttggaacaaactgttggaagatgattga
agcaatacctgcttggttaaaatgcacttggcggcatcatgatcgtacattttttaatggagtagcataccacatcattg
agaaaggtcctatattcagcattatgtcattcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatt
tgcaatccatgtacgttatgtattgatgtttacaaggaacaaatttgcttgctttttagcttttattcttgtgaggagga
ggacatgggaaaaagggacttatgggttctccgagaaaaaacgttgaaacaattgtgtccttttatttatccttttgatg
cttatgatacaatcgggattagtatagataatgacctcttaatggaaagaagagattacgataagggcgtagcagatctg
catttgtgtaattacgaatccaagcaagttattgaaacaggaattgagttggccgtcatgaaatatggcgaaatggaatt
tttgtttgcaattacttacatagaaactttacccttactcaattaa
back to top
>KJ396616.1-SFB1125
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccttcgttcggtttct
gtgtacatgcaagtcatggagtgatttgattggaagctcaagttttggaagaacacaccttcataggaacgtcacaaaac
ttgcccatgtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccatatgatatagaa
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggctgtaagaatgatgcagaccaacaaagatgtcttctccgttgaggttta
tagtcgtagaacaaattcttggaggatgattgaaacaattcctccttggttaagaagcacttggcggcaacatcagggta
tattttttaatggagtagcataccatgtcattaacaaaagtcatacattcatcattatgtcattcgattatgccagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttctgtatcatcgtttacaacgaacaaatttg
cttggtttctggatattatgatggtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtacaatagggattagtatagataataaactctta
atgctaagaagaaatgacattagcggtatagcagatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaagtttggttttactca
attga
back to top
>KJ396615.1-SFB993
atgatcctagtaagactacctgcaaaatccctcattcggtttctgtgtacatgcaagtcatggagtgatttgattggcag
ctcgagttttgttagcacgcaccttcataggaatgtcagaaaacatgcccatgtgtatctcctctgcctccaccacccaa
atgttagacgtcaggtggaccctgatgacccatatgttaaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtacttcaagttaagccatcccttagggagcccagaatattttgtgatatatggttcaagcaacggtttagtttg
catttcggatgagatattgaatttcgatagcccaatatacatatggaacccatcggttaggaaatttaggaccattccaa
tgagcaccaacatcaacattaaatttagctatgatgctctccaattcgggttccacccccggattaatgactacaaggct
gtaaggatgatgcgtaccaacaaaagtgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatcttaagggtacattttttggtggagtatcataccacatcattc
agaaaggtcctatattcagcattgtgtccttcgattcaggcagtgaagaattcgaagaattcatagcaccagacgccatt
tgccgtccatttgcgttatgtattgacgtctacaaggagcaaatttgtttgctttttagattttattcttgtgtggatga
ggacatggcaaaaaatgacttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcttgata
gctatggtacaatcgggattagtatagataatgaactcttattggaaagaagagattttattaggggcataggagatctg
tgtttgggtgattacgaatccaaacaagtttaa
back to top
>KJ396614.1-SFB1086
atgatcctagtaagactacctgcaaaatccctcattcggtttctgtgcacatgcaagtcatggagtgatttgaattgcag
ctcagcttttagcacgacactccataataggaatgtcagaaaacatgcccatgtttatctactctgcctccaccacccaa
atgttagacgtctggtcaaccgtgatgacccatatgttaaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtacttcaagttaagccatcctttagggagcccagaatattttgtgatatatggttcaagcaacggtttagtttg
catttcggatgagatattgaatttcgatagcccaatatacatatggaacccatcggttaggaaatttaggaccattccaa
tgagcaccaacatcaacattaaatttagctatgatgctctccaattcgggttccacccccggattaatgactacaaggct
gtaaggatgatgcgtaccaacaaaagtgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatcttaagggtacattttttggtggagtatcataccacatcattc
agaaaggtcctatattcagcattgtgtccttcgattcaggcagtgaagaattcgaagaattcatagcaccagacgccatt
tgccgtccatttgcgttatgtattgacgtctacaaggagcaaatttgtttgctttttagattttattcttgtgtggatga
ggacatggcaaaaaatgacttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcttgata
gctatggtacaatcgggattagtatagataatgaactcttaatggaaagaagagattacgataagggcgtaggagatctg
catttgtgtaattacgaatccaagcaagttattgaaacaggaattgagttggccgtcatgaaatatggcgaaatggaatt
tttgtttgcaattacttacatagaaactttacccttactcaattaa
back to top
>KJ396613.1-SFB1128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtacaagcaagtcttggagtgaattgattggcagctcgagttttgttagcacacaccttcatagaaatgacacaaaac
atgcccacgtctatttactttggctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtcttttttttccatagaaacatttgagaagtgctttgagttaagacaccccttagggagcacagaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcgatcaggaaatttaggacccctccaatgagcaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccacccccgggttaatgactacaagattataagaatgatgcgtaccaacaaagatgccttcaccgttgaggt
ttatagtcttggaacagactcttggaagatgattgaagcaatcccgccctggttaaaatgcacttggcagcatcaaatgg
gtacattttttaatggtgtagcataccacatcattcagaaaggtcctatattcagcgttatctcattcgattcagacagt
gaagaattccaagaattcatagcaccagatgccatttgcagttcatgggggttatgtatcaacgtttacaaggaacaaat
ttgcttgctttttagattttatggttgtgaggaggagggcatggaacaagttgacttctgggttatacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>KJ396612.1-SFB1131
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccagttgtatatgctttgcttccaccacccaaatgttagacgtcataacgacactgatgacccatatgtcaaagaa
gaacttcagtggtcatttttttccaatgaaacctttgaggagttcttcaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaagggtttagtttgcatttcggatgagatattgaatttcgatagtcccatacacataa
ggaacccatcagttagtaaatttaagaaccctccaatgagcaacaaccttaaccttaaatttgcgtatggtgcttttcaa
ttcgggtttcaacccggggttaatgactacaagggcgttagagtggttggtaccaacaaagatgccttggcggtggaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaaatcctccctgggtaaaaagcacttggaaacctcatcagg
gtaccttttttaagggagtagcatatcacatcattgagaaaggtcctttattcagccttatgtcatttgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgctttttagattttattgttgtgagggagaaggcatggaaaaaaaggattggtgggttctgcaagaaaaccggt
ggaaacaatttcgtccttttatttatccttcggatgattgttatcgtacaatcgggattagtatagatagtaaaatctta
atggtaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacagg
aattaagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactca
atcattcttaa
back to top
>KJ396611.1-SFB1128
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttccgtatct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaactccataggattgtcacaaaac
atgcccatgtctatatgctctgcctccaccccccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcctttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattcttgtgaggagggcatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaattgtgtccttttatttatccttcggattattattatcgtacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacgttaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactcaatc
attcttaa
back to top
>KJ396610.1-SFB996
atggacatcctagtaagactacctgcaaaatccctccttcggtttctgtgcacatgcaagtcatggtgtgatttgatcgc
aagctcaggttttatcagtacacaccttaatagggatgtcagaaaacatgcccatgtctgtctactttgcctacaccacc
caagttttgaacgtctggtcaaccgtgatgacccatatgtcaacaaagaatttcaatggtctcttttttccaatgaaaca
tttgaggagtacttcaagttaagccatcctttagggagcccagaatattttgtgatatatggttcaagcaacggtttagt
ttgcatttcggatgagatattgaatttcgatagcccaatatacatatggaacccatcggttaggaaatttaggaccattc
caatgagcaccaacatcaacattaaatttagttgtgttgctctccacttcgggttccacccccggattaatgactacaag
gctgtaaggatgatgcgtaccaacaaaagtgccttggcggttgaggtttatagtctcagaacagactcttggaagatgat
tgaagcaattcctccttggttaaaatgcacttggcagcatcttaagggtacattttttaatggagtagcgtaccacatca
ttcagaaaggtcctatcttcagcattgtgtccttcgattccggcagtgaagaattcgaagaattcatagcaccagacgcc
atttgccgtccatgtgcgttatgtattgatgtctacaaggagcaaatttgtttgctttttagattttattcttgtgtgga
tgaggacaaggcaaaaaatgagttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcatg
atagctatggtacaatcgggattagtatagataatgaactcttattggaaagaagagattttattaggggcataggagat
ctgtgtttgggtgattacgaatccaaacaagtttaa
back to top
>KJ396609.1-SFB1125
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacacaccttcataggaacgtcacaaaac
ttgcccatgtctatgtacttggcctccaccatccaaattttgaacgtcagaacgacactgatgacccatatgataaagac
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcctttagaagacacagaaca
ttatgggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcccatgagcaccaacaacattaagtatagctatgttgctctccaattc
gtgttgcatcccggggttagtgactacaaggctgtaagaatgatgcatgccaacaaagaagtattcgcggttgaggttta
tagtcttagaacaaattcttggaagatgaatgaaacaattcctccttgggtaagatgcacttggcagccacctcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatatattcagcattatgtcattcgattcaggcaggcaa
gaatttcaagaattcatagcaccagatgccattcgcagtttatgggggttgtgtatggacgttcacaaggaacaaattag
cttgctttctggatattatggttgggaggaggagggcatggacaaaattgacttatgggttgggcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtgcaatagggattagtatagataataaactctta
atgctcagaagaaatgacattagcggtattgctgatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaactttacccttactca
attga
back to top
>KJ396608.1-SFB1128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtacaagcaagtcttggagtgatttgattggcagctcgagttttgttaacacacaccttcatagaaatgacacaaaac
atgcccacgtctatctactttgcctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtctcttttttccaatgaaacatttgagaagtgctttgagttaagacaccccttagggagcacaaaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcgatcaggaaatttaggacccctccaatgagcaccaacattaacattaaagatagctatgttgctctccaa
ttcgggttccaccccggggttaatgactacgagattatgagaatgatgcgtaccaacgaagatgccttcgccgttgaggt
tcatagtcttgaaacagactcttggaagatgattgaaccactcccgccctggttaaaatgcacttgtcaccatcatatgg
gtacattttttaatgctgtagcataccatatcattcataaaggtcctatattcatcgttatctcattcgattcagacaga
gaagaattccacgaattcatagcaccagatgccatttgcatttcatgggggttatgtatcaacgtttacaaagaacaaat
ttgcttgctttttagattttatggtggggaggaggagggcatggaacaagttgacttctcggctctacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>KJ396607.1-SFB1131
atggcattcaccctacgtaagaaagaaatcttaatcgacgtcctagtaagactacctgcaaaatccgtcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaaaaggaatgtcacaaaac
acgcccaggtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttccaatgaaacgtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgccttggcagttgaagt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcattataagg
gtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtttacaatcaacaaat
ttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttctccaagaaaaacggt
ggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatagataataaactctta
atgcaaagaacagattacaatatgggcattgcagatctgcatttgtgtgattacgaatccaagcaagttcttgaaacaag
gattaagttggccctcgtgaaatatggcgaaatcgaatttgtgttttcaattacttacatagaaagtttggttttactca
ataattattaa
back to top
>KJ396606.1-SFB1128
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcatacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttatgctggggaggaggccatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaactgggtcctcttatttatcctccggaattattattacggacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactcaatc
attcttaa
back to top
>KJ396605.1-SFB1128
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgctcggtttct
ttgtacatgcaagtcatggagtgatgtgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggagacatcatcagg
gtacattttttaacggagtagcatatcacatcattgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattctggggaggagggcatggaaaaaattgacttatgggttctgcaagaaaacaggtgga
cacaattgtgtcgtttaatttatccttcggattattattatcgaacaatcggatttagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactcaatc
attcttaa
back to top
>DQ646491.1-SFB1253
tttgctattgtcaaccgcaaaagtgggtcattcgactttctgcaaaaaatgaaaagcaccattgttttccttgttttgtt
atgatcaatattttggatgctaacttattttgattatgattttcttcaggatgacattcagactacataagaaagaaatc
ttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtgatttgct
tggaagctcaagttttggcagcacacaccttcataggaacgtcacaaaacttgcccatgtctatctactttgcctccacc
atccaaattttgaacgtcagaacgacactgatgacccaaatgatatagaacaacttcaatggtcacttttttccaatgaa
acatttgagcagttctccgagttaagccctcccttagaaaacaaagaacattataggatatatggttcaagcaatggttt
ggtttgcatttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaggatcc
ctcctataagcaccaacaacattaagtttagctatgttgctctccaattcgggttccatcccggggttagtgactacaag
gctgtaagaatgatgcataccaacaaagatgtcttcgcggttgaggtttatagtcttagaacaaattcttggaagatgat
tgaaacaattcctccttggttaagatgcacttggcagcaacatcagggtatattttttaatggagtagcataccatgtta
ttaacaaaggtcatatattcagcattatgtcattcgattcaggcagtgaagaatttcaagaattcatagcaccagatgcc
atttgcagtttatgggggttctgtatcgacgtttacaaggaacaaatttgcttgctttctggatattatggttgtgagga
ggagggcatggacaaaattgacttatgggttctgcaagaaaaacggtggaaacaattatgtccttttacttatcctttgg
attattattattatcgtacaatagggattagtatagataataaactcttaatgctaagaagaaatgacattagcggtata
gcagatctgcatttgtgtgattacgaatccaagcaagttcttaaaacaggaattaagctggccaccatgaaatatggcga
aatggaattcttgttttctattacttacatagaaactttacccttactcaatt
back to top
>DQ646490.1-SFB1249
tttactattgtcaaccgcaaaagtgagtgattggactttctgcagaaattggaaagcactttgttttccaaactttgttt
tgttatgatccattcttattaacttattttgattatgattttctacaggatgacattcacaccacgtaagaaaaaaatct
tgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttctttgtacatgcaagtcatggagtgatttgatt
ggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaacatgcccatgtctatatgctctgcctccacca
cccaaattttgaacgtcataacgacactgatgacccatatgacatagaagaacttcagtggtcacttttttccaatgaaa
cgttcgagcagttctccaagttaagccatcccttaggaagcacagaacattatggggtatatggttcaagcaatggttta
gtttgcatttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcaattagtaaatttaggacccc
tccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaattcgggttccaccctggggttaatgactaca
aggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggtttatagtcttcaaacagactcttggaagatg
attgaagcaattcctccttggttaaaatgcacttggaaacatcatcagggtacattttttaacggagtagcatatcacat
catcgagaaaggtcctctattcagcattatgtcattcgattcaggcagtgaagaattcaaagaattcatagcaccagatg
ccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaatttgcttgcttcttatgttttattcttgtgag
gagggcatggaaaaaattgacttatgggttctgcaagaaaaccggtggaaacaattgtgtccttttatttatccttcgga
ttattattatcgtacaatcgggattagtatagatagtaaaatcttaatgctaagagcagatcacattaggggcatattag
atatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaattaagttggccaccgtgaaatatggcgaaatc
gaattcttgttttcaattacttacatagaaactttactcttactcaatt
back to top
>DQ646489.1-SFB1091
acatcctagtaagactacctgcaaaatccctcgttcggtttctgtgtacaagcaagtcttggagtgatttgattggcagc
tcgagttttgttagcacacaccttcatagaaatgacacaatacatgcccacgtctatctactttgcctccacccctcaaa
ttttgaatgggcggtcgatcctgatgacccatatgttaaacaagaacttcaatggtctcttttctccaatgaaacatttg
agaagtgctttgagttaagacaccccttagggagcacagaacattatggaatatatggttcaagcaatggcttagtttgc
atttcggatgagatattgaatttcgatagtcctatacacatatggaatccatcgatcaggaaatttaggacccctccaat
gagcaccaacattaacattaaatatagctatgttgctctccaattcgggttccacccccgggttaatgactacaagatta
taagaatgatgcgtaccaacaaagatgccttcaccgttgaggtttatagtcttggaacagactcttggaagatgattgaa
gcaatcccgccctggttaaaatgcacttggcagcatcaaatgggtacattttctaatggtgtagcataccacatcattca
gaaaggtcctatattcagcgttatctcattcgattcagacagtgaagaattccaagaattcatagcaccagatgccattt
gcagttcatgggggttatgtatcaacgtttacaaggaacaaatttgcttgctttttagattttatggttgtgaggaggag
ggcatggaacaagttgacttctgggttctacaagaaaaacgatggaaccaattgtgtccttttatttatcctcggagctg
ttatcgtataatggggattagtataaataatgaactcatattgcaaaaacgagatctcaataagggcgtagcttatctat
atctctgtaattacaaatccaagcaagttcttgaaacaggaattacgttggctatcgtgacatatgacgatatcgaattc
ttgttttcaattacttacatacaaagcttggttttgctaaataattattaa
back to top
>DQ646488.1-SFB1094
acatcctagtaagactacctgcaaaatccgtcgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagc
tccagttttgttagcatacaccttaaaaggaatgtcacaaaacacgcccatgtctacttactctgcctccaccacccaaa
ttttgaacgccagaacgacaatgatgacccatatgatatagaagaacttcaatggtcacttttttccaatgaaacgtttg
agcagttctccaatttaggccatcctttagaaaacacagagcattataggatatatggttcaagcaatggtttagtttgc
atttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaagtttaagacccctccaat
gagcaccaacattaacatgaaattttcccatgttgctctccaattcgggttccaccccggggttaatgactacaagactg
taagaatgatgcgtaccaacaaaggtgccttggcagttgaagtttatagtctcagaacagactcttggaagatgattgaa
gcaattcctccttggttaaaatgcacttggcagcattataagggtacatttttcaatggagtagcataccacatcattaa
gaaaggtcctatattcagcgttatatcatttgattcaggcagtgaagaattcgaagaattcatagtaccagatgccatta
ccagttcatgggggttatgtattgacgtttacaatcaacaaatttgcttgcttcttaagttttattcttgtgaggaggag
ggcatggacaaaattgactcatgggttctccaagaaaaacggtggaaacaattgtgtccttttatttttcctttggatga
ttactattctacaatcgggattagtatagataataaactcttaatgcaaagaacagattacaatatgggcattgcagatc
tgcatttgtgtgattacgaatccaagcaagttcttgaaacaaggattaagttggccctcgtgaaatatggcgaaatcgaa
tttgtgttttcaattacttacatagaaagtttggttttactcaataattattaa
back to top
>DQ849118.1-SFB1131
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacacaccttcataggaacgtcacaaaac
ttgcccatgtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccaaatgatatagaa
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggctgtaagaatgatgcataccaacaaagatgtcttcgcggttgaggttta
tagtcttagaacaaattcttggaagatgattgaaacaattcctccttggttaagatgcacttggcagcaacatcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatatattcagcattatgtcattcgattcaggcagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttctgtatcgacgtttacaaggaacaaatttg
cttgctttctggatattatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtacaatagggattagtatagataataaactctta
atgctaagaagaaatgacattagcggtatagcagatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaagtttggttttactca
attattattaa
back to top
>DQ849090.1-SFB1041
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttattcggtttct
gtgtacatgcaagtcatggagtgatttgattggaagctcaatttttgttggcacacacctttgtaggaatgtgacaaaac
atacccatgtttatctactctgtctccaccacccaaattttgaacgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctttttttcccaatgaaacatttgaggagtgctacaaactaagacatcccttagggatcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttctgatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaaattaggacccctccaatgagcaccaacattaacatcaaatttagctcttttgctctccaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgttgcgtaccaacaaaaatgccttggctgttgaggt
ttatagtcttagaacagactgttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gcacattttttaatggagtagcataccacatcatccagaagggtcctctattcagcattatgtcgttcgactcaggcagt
gaagaattccaagaattcatagcaccagatgcaatttgccgtccatctgagttatgtattgacgtttacaaggaacaaat
ttgcttgctttttggattttatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatgtttcctttggatcgttgtcaccgaacaatcagtattagtgcagataatgaactctta
atggaaagaagagatttcattaagggcataacatatctgtgtttgtgtaattacgaatccaagcaagttcttgaaacagg
a
back to top
>DQ849089.1-SFB972
ctcattcggtttctgtgcacatgcaagtcatggtgtgatttgattggcagctcaggttttatcagtacacaccttaatag
gaatgtcagaaaacatgcccatgtctgtctactttgcctacaccacccaagttttgaacgtctggtcaaccgtgatgacc
catatgttaaaaaagaatttcaatggtctcttttttccaatgaaacatttgaggagtgctacaagttaagccatccctta
gggagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaggaaatttaagacccctccaatcagcaacaacattaacattaaatttagtt
gtgttgctctccacttcgggttccaccccggggttaatgactacaaggctgtaaggatgctgcgtaccaacaaagatgcc
tttgcagttgaggtttatagtcttggaacgaactgttggaagatgattgaagcaatacctgcttggttaaaatgcacttg
gcggcatcatgatcgtacattttttaatggagtagcgtaccacatcattgagaaaggtcctatattcagcattatgtcat
tcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatttgcaatccatgtacgttatgtattgatgtt
tacaaggaacaaatttgcttgctttttagcttttattcttgtgaggaggaggacatgggaaaaagggacttatgggttct
ccgagaaaaacggtggaaacaattgtgtccttttatttatccttttgatggttatgatacaatcgggattagtatagata
atgaactcttaatggaaagaagagattacgataagggcgtagcagatctgcatttgtgtaattacgaatccaagcaagtt
attgaaacagga
back to top
>DQ849088.1-SFB978
gtcgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaaaag
gaatgtcacaaaacacgcccatgtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacc
catatgatatagaagaacttcaatggtcacttttttccaatgaaacgtttgagcagttctccaatttaagccatccttta
gaaaacacagagcattataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttccc
atgttgctctccaattcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgcc
ttggcagttgaagtttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttg
gcagcattataagggtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcat
ttgattcaggcagtgaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtt
tacaatcaacaaatttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttct
ccaagaaaaacggtggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatag
ataataaactcttaatgcaaagaacagattacaatatgggcattgcagatctgcatttgtgtgattacgaatccaagcaa
gttcttgaaacaaggatt
back to top
>DQ849087.1-SFB977
ctcgttcggtttctgtgtacatccaagtcatggagtgatttgattggcggctcgagttttgttagcgcacaccttaatag
gaatgccacaaaacatgcccatgtctgtctactttgtctccaccacccaaattttgaacgtctggtcaaccgtgatgacc
catattttaaaaaagaatttcaatggtctctttattccaatgaaacatttgaggagttctccaagttaagccatcccgta
gggagcacagaacattatgtgatatatggctcaagcaatggtttagtttgcatatccgatgagatactgaatttcgatag
tcctatatacatatggaacccatcagttaggaaatttaggaccactccaatgagcaccaacattaacattaaatttagct
atgttgctctccaattcgggttccacccccgggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgcc
ttggcggttgaggtttatagtctcagaacagactcttggaagatgattgaagcaattcctccgtggttaaaatgcacttg
gcagcattataagggtacattttttgacggagtagcatatcacgtcattcagaaaggtcctatattcagcattttgtcct
tcaattcaggcaatgaagaattcgaagaatttatagcaccagatgccatttgcggtacatttgggttatgtatcgacatt
tacaaggaacaaatttgtttgctttttagatgttatggttgtgaggaggagggcatgaacaaagttgacttatgggttct
gcaagaaaaacggtggaaacaattgtgtccttttatttttccattggatgaatggagtggtgcaatcgggattagtatag
atgatgaactcttaatggcaataacagatttcgataagggcgtagcagatctatatttgtgtaattacgaatgccaggat
gttcttgaaacaggaat
back to top
>DQ849086.1-SFB1036
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattcttgtgaggagggcatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaattgtgtccttttatttatccttcggattattattatcgtacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacag
back to top
>DQ849085.1-SFB975
gttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaacaggaa
tgtcacaaaacatgtccatgtctatttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccat
atgataaagaagaacttcaatggtcactttttgccaatgaaacgtttaagcatttctccaatttaagccatcccttagaa
agcacagagcattatatgatatatggttcaagcaatggtttagtttgtatttcggatgagataatgaatttcgatagtcc
tatatacatatggaacccatcggttaggaaatttaggaccactcaaatgagcaccaacattaacattaaattttcccatg
ttgctctccaattcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgaaccaacaaaggtgccttt
gtagtggaggtttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggca
gcagcttaagggtacattttttaatggagtagcataccacattattgagaaaggtcctataatcagcgttatatcattcg
attcaggcagcgaaaaattcgaagaattcatagcaccagatgccatttgcgatacatgggggttatgtattgacatgtac
agggaacaaatttgcttgctttgtagatgttatgggtgcgaggaggagggcatggaaaaagtggacttatgggttctgca
agaaaaacggtggaaacaattgtgtccttttacttttcctttggatgaatggaatgttacaatcgggattactaaagatt
atgaactcttaatggaaataagagatttcgataatggcgtggcagatctgtatttgtgtaattacgactccaaggaagtt
cttaaaacaggaata
back to top
>DQ849084.1-SFB1128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtactagcaagtcttggagtgatttgattggcagctcgagttttgttagcacacaccttcatagaaatgacacaatac
atgcccacgtctatctactttgcctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtctcttttctccaatgaaacatttgagaagtgctttgagttaagacaccccttagggagcacagaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaatccatcgatcaggaaatttaggacccctccaatgagtaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccacccccgggttaatgactacaagattataagaatgatgcgtaccaacaaagatgccttcaccgttgaggt
ttatagtcttggaacagactcttggaagatgattgaagcaatcccgccctggttaaaatgcacttggcagcatcaaatgg
gtacattttctaatggtgtagcataccacatcattcagaaaggtcctatattcagcgttatctcattcgattcagacagt
gaagaattccaagaattcatagcaccagatgccatttgcagttcatgggggttatgtatcaacgtttacaaggaacaaat
ttgcttgctttttagattttatggttgtgaggaggagggcatggaacaagttgacttctgggttctacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>AM746963.1-SFB992
gacatcctagcaagactaactgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtgatttgattggcag
ctcaagttttgttagcacacacctaaacaggaatgccacaaaacatgcccatctctatctactctgcctccaccactcaa
attttgaacgtcaggctgatcctgatgacccgtatgtcaaacaagaatttcaatggtctcttttttcgaatgaaacattt
gaggagtgctccaagttaagccatcccttagggagcacagaaccttatgtgatttatggctcaagccatggtttagtttg
catttccgatgagataatgaatttcgatagtcccatacacatatggaacccgtcggttaagaaatttaagacccttccaa
taagcaccaatattaacattaaatttagccatgttgctctccaattcgggttccaccccggggttaatgattacaaggct
ataaggatgttgcgtaccaacaaaaatgccttggtggttgaggtttatagtctcagagcagactcttggatgatgattga
agcaattcctccttggttaaaatgcacttggcagcatcatgacggtacattctttaatggagtggcataccacatcattg
aaaaaggtcctatattcagtattatatccttcgattcaggcagtgaagaattcgaggaattcatagcaccggatgccatt
tgcagttcgtggcgattatgcatccacgtttacaaggaacaaatttgcttgtttttcggattttatggttgtgaggaggg
catggaaaaaattgacttatggggtctgcaaaaaaaacggtggaaaaaattgtgtccttttatttatgatccttttgatt
attgttatcgtataattgggattagtatagataatgaactcttaatgggaagagaaggttttgctaagggtgtagcagat
ctggaattgtggaattacgaatccaaacaggt
back to top
>AM746962.1-SFB992
gacatcctagcaagactgccagtaaaatccctggttcggtttctgtgcacatgcaagtcatggagtgatttgattggcag
ctccagtttagttagcacacatcttcataggaatgtcacaaagcatgaccatgtctatttactttgtctccaccactcaa
attttgaacttcaggctgaccctgatgacccatatgttaaacaagaatttcaatggtcccttttttccaatcagacattt
gagcagtgctccaagttaagccatcccttagggagcacagaacattatgtgatatatggctcaagcaatggtttagtttg
tatttcggatgagatattgaatttcgatactcctatatacatatggaacccatcggttaggaaacttaggacccttccaa
tcagcaccaacattaacattaaatttagtcatgttgctctccaattcgggtttcaccccgtggttaatgactacaaggct
gtaaggatgatgcgcacgaacaaaaatcccttggcggttgaggtttatagtcttagaacagactcttggaaaatgattga
agtaattccaccttggttaaaatgcacttggaaacatcataagggtacatttcttaatggagtagcataccacatgattc
agaaaggtcctatattcagcattgtgtcgtttgattcaggcagtgaagaattccaagaattcatagcaccagatgccatt
tgcaatccatgtgagttggtacgtattgacgtttacaaggaacaaatttgcttgctttgtagcttgtatccttcttctga
ggatggcatgggaaaaaatgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttgtttatcctcttg
attgcgatggtacaatagggattagtatagataatgaactcttaatggaaaaaagagatttcgataggggcatagcaaat
gtgcatttgtgtaattacgaatccaaacaggt
back to top
>AM746961.1-SFB992
gacatcctagtaagactgccagcaaaatccctcgttcggtttctgtgtacatccaagtcatggagtgatttgattggcgg
ctcgagttttgttagcgcacaccttaataggaatgccacaaaacatgcccatgtctgtctactttgtctccaccacccaa
attttgaacgtctggtcaaccgtgatgacccatattttaaaaaagaatttcaatggtctctttattccaatgaaacattt
gaggagttctccaagttaagccatcccgtagggagcacagaacattatgtgatatatggctcaagcaatggtttagtttg
catatccgatgagatactgaatttcgatagtcctatatacatatggaacccatcagttaggaaatttaggaccactccaa
tgagcaccaacattaacattaaatttagctatgttgctctccaattcgggttccacccccgggttaatgactacaaggct
gtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccgtggttaaaatgcacttggcagcattataagggtacattttttgacggagtagcatatcacgtcattc
agaaaggtcctatattcagcattttgtccttcaattcaggcaatgaagaattcgaagaatttatagcaccagatgccatt
tgcggtacatttgggttatgtatcgacatttacaaggaacaaatttgtttgctttttagatgttatggttgtgaggagga
gggcatgaacaaagttgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttttccattggatg
aatggagtggtgcaatcgggattagtatagatgatgaactcttaatggcaataacagatttcgataagggcgtagcagat
ctatatttggggaattacgaatccaaacaagt
back to top
>DQ992485.1-SFB1083
atcctagtaagactacctgcaaagtccctcgttcggtttctttgcacatgcaagtcatggagtgatttgattggcagctc
gagttttgttagcatacacgttaacaggaatgtcacaaaacatgcccatgcccatttactctgcctccaccacccaaatt
ttgaacgccagaacgacaatgatgacccatatgatatagaagaacttcaatggtcgcttttttccaatgaaacgtttgag
cagttctccaagttgagccatcccttagaaagcacagagcagtataggatatatggttcaagcaatggtttagtttgctt
ttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaggacccctccaatga
gcaccaacattaacatcaaattttcctatgttgctctccaattcgggttccaccccagggttaatgactacaaggctgta
aggatgatgcgtaccaacaaaggtgccttggcagttgaggtatatagtcttagaacagactcatggaaaatgattgaaac
aattcctccttggttaatatgcacttggcagcatcataagggtacattttttaatggagtagcataccacgtcattcaga
aaggtcctatattgagtattatgtcattcgattcaagcagtgaagaattcgaagaattcatagcaccagatgccatttgc
agttcctggaagttatgtatcaacatttacaaggaacaggtttgcttgctttttggattttatggttgtgaagaggaagg
catggaaaaaattgacttatgggttctagaagaaaaacggtggaaacaactgtgtccttttatttatcctggggattatt
gttataatgtggtcgggattagtatagataatgaactcttaatggcaagaggaggcttcgatatgggcatagcagatctg
tatttgtgtaattacaaatccaagaaagttattgaaacaggaattaaattggccgtcaaggaatatggcgaaatcgaatt
cttgtttgcaattacttacctagaaactttaccattactcaat
back to top
>DQ989579.1-SFB1084
atcctagtaagactacctgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtgatttgattggcagctc
aagttttgttagcacacacctaaacaggaatgccacaaaacatgcccatctctatctactctgcctccaccactcaaatt
ttgaacgtcaggctgatcctgatgacccgtatgtcaaacaagaatttcaatggtctcttttttcgaatgaaacatttgag
gagtgctccaagttaagccatcccttagggagcacagaaccttatgtgatttatggctcaagccatggtttagtttgcat
ttccgatgagataatgaatttcgatagtcccatacacatatggaacccgtcggttaagaaatttaagacccttccaataa
gcaccaatattaacattaaatttagccatgttgctctccaattcgggttccaccccggggttaatgattacaaggctata
aggatgttgcgtaccaacaaaaatgccttggtggttgaggtttatagtctcagagcagactcttggatgatgattgaagc
aattcctccttggttaaaatgcacttggcagcatcatgacggtacattctttaatggagtggcataccacatcattgaaa
aaggtcctatattcagtattatatccttcgattcaggcagtgaagaattcgaagaattcatagcaccggatgccatttgc
agttcgtggcgattatgcatccacgtttacaaggaacaaatttgcttgtttttcggattttatggttgtgaggagggcat
ggaaaaaattgacttatggggtctgcaaaaaaaacggtggaaaaaattgtgtccttttatttatgatcctttagattatt
gttatcgtataattgggattagtatagataatgaactcttaatgggaagagaaggttttgctaagggtgtagcagatctg
gaattgtgcaattacgaatccaagcttatacgtgaaacaggaattaagttgggcatcatgacatatgcggaaatcgaatt
cttgttttcgattacttacgtagaaactttacctcttctcaatt
back to top
>DQ989578.1-SFB1081
atcctagtaagactacctgcaaaatccctcattcggtttctgtgcacatgcaagtcatggtgtgatttgattggcagctc
aggttttatcagtacacaccttaataggaatgtcagaaaacatgcccatgtctgtctactttgcctacaccacccaagtt
ttgaacgtctggtcaaccgtgatgacccatatgttaaaaaagaatttcaatggtctcttttttccaatgaaacatttgag
gagtgctacaagttaagccatcccttagggagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcat
ttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaagacccctccaatca
gcaacaacattaacattaaatttagttgtgttgctctccacttcgggttccaccccggggttaatgactacaaggctgta
aggatgctgcgtaccaacaaagatgcctttgcagttgaggtttatagtcttggaacgaactgttggaagatgattgaagc
aatacctgcttggttaaaatgcacttggcggcatcatgatcgtacattttttaatggagtagcgtaccacatcattgaga
aaggtcctatattcagcattatgtcattcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatttgc
aatccatgtacgttatgtattgatgtttacaaggaacaaatttgcttgctttttagcttttattcttgtgaggaggagga
catgggaaaaagggacttatgggttctccgagaaaaacggtggaaacaattgtgtccttttatttatccttttgatggtt
atgatacaatcgggattagtatagataatgaactcttaatggaaagaagagattacgataagggcgtagcagatctgcat
ttgtgtaattacgaatccaagcaagttattgaaacaggaattgagttggccgtcatgaaatatggcgaaatggaattttt
gtttgcaattacttacatagaaactttacccttactcaatt
back to top
>EF490571.1-SFB976
ctcgttcggtttctttgcacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcatacacgttaacag
gaatgtcacaaaacatgcccatgcccatttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacc
catatgatatagaagaacttcaatggtcgcttttttccaatgaaacgtttgagcagttctccaagttgagccatccctta
gaaagcacagagcagtataggatatatggttcaagcaatggtttagtttgcttttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacatcaaattttcct
atgttgctctccaattcgggttccaccccagggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaggtgcc
ttggcagttgaggtatatagtcttagaacagactcatggaaaatgattgaaacaattcctccttggttaatatgcacttg
gcagcatcataagggtacattttttaatggagtagcataccacgtcattcagaaaggtcctatattgagtattatgtcat
tcgattcaagcagtgaagaattcgaagaattcatagcaccagatgccatttgcagttcctggaagttatgtatcaacatt
tacaaggaacaggtttgcttgctttttggattttatggttgtgaagaggaaggcatggaaaaaattgacttatgggttct
agaagaaaaacggtggaaacaactgtgtccttttatttatcctggggattattgttataatgtggtcgggattagtatag
ataatgaactcttaatggcaagaggaggcttcgatatgggcatagcagatctgtatttgtgtaattacaaatccaagaaa
gttattgaaacaggaa
back to top
>KJ396620.1-SFB.m11131
atggcattcaccctacgtaagaaagaaatcttaatcgacgtcctagtaagactacctgcaaaatccgtcgttcggtttct
ttgtacatgcaggtcatggagtggattgattggcagctccagttttgttagcatacaccttaaaagggatgtcacaaaac
acgcccatgtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttacaatgaaacgtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgccttggcagttgaagt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcattataagg
gtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtttacaatcaacaaat
ttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttctccaagaaaaacggt
ggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatagataataaactctta
atgcaaagaacagattacaatatgggcattgcagatctgcttttgtgtgattacgaatccaagcaagttcttgaaacaag
gattaagttggccctcgtgaaatatggcgaaatcgaatttgtgttttcaattacttacatagaaagtttggttttactca
ataattattaa
back to top
>KJ396619.1-SFB.m11125
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacccaccttcataagaaggtcacaaaac
tggcccaggtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccatatgatatagaa
caacttcaatggtcacttttttccactgaaacatttgagcagttcttcgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggccgtgagaatgatgcataccaacaaagatgtcttcgcggttgaggttta
tagtcttagaacaaattcttggaagatgattgaaacaattcctccttggttaagatgcacttggcagcaacatcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatattttcagcattatgtcattcgattcaggcagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttgtggatcgacgtttacaaggaacaaatttg
cttgctttctggatattatggttgtgaggaggagggcatggacaaaattgatttatgggttttgcaagaaaaacggtgga
aacaattacgtccttttacttatcctttggattattattattatcgtacaatggggattagtatagataataaactatta
tcgctaagaagaaatgacattagcggtatagcagatctgcacttgtgtgatttcgaatacaagcaagtactaacaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaagtttggttttactca
attag
back to top
>KJ396618.1-SFB.m11131
atggcattcaccctacgtaagaaagaaatcttaatcgacgtcctagtaagactacctgcaaaatccgtcgttcgatttct
ttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaaaaggaatgtcacaaaac
acgcccatgtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttccaatgaaacgtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttttaggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgccttggcagttgaagt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcattataagg
gtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtttacaatcaacaaat
ttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttcttccagaaaaacggt
ggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatagataataaactctta
atgcaaagaacagattacaatatgggcattgcagatctgcatttgtgtgattacgaatccaagcaagttcttgaaacaag
gattaagttggccctcgtgaaatatggcgaaatcgaatttgtgttttcaattacttacatagaaagtttggttttactca
ataattattaa
back to top
>KJ396617.1-SFB.m11086
atgatcctagtaagactacctgcaaaatccctcattcggtttctgtgcacatgcaagtcatggtgtgatttgattggcag
ctcaggttttattagaacacaccttaataggaatgtcagaaaacatgcccatgtctgtctactttgcctccaccacccaa
attttgaacgtctggtcgaccgtgatgacccatatgttaaaaaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtgctacaagttaagccatcccttagggagcacagaacattatgtgatatatggttcaagcaatggtttagtttg
catttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaagacccctccaa
tcagcaacaacattaacattaaatttagttatgttgctctccaattcgggttccaccccggggttaatgactacaaggct
gtaaggatgctgcgtaccaacaaagatgcctttgcagttgaggtttatagtcttggaacaaactgttggaagatgattga
agcaatacctgcttggttaaaatgcacttggcggcatcatgatcgtacattttttaatggagtagcataccacatcattg
agaaaggtcctatattcagcattatgtcattcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatt
tgcaatccatgtacgttatgtattgatgtttacaaggaacaaatttgcttgctttttagcttttattcttgtgaggagga
ggacatgggaaaaagggacttatgggttctccgagaaaaaacgttgaaacaattgtgtccttttatttatccttttgatg
cttatgatacaatcgggattagtatagataatgacctcttaatggaaagaagagattacgataagggcgtagcagatctg
catttgtgtaattacgaatccaagcaagttattgaaacaggaattgagttggccgtcatgaaatatggcgaaatggaatt
tttgtttgcaattacttacatagaaactttacccttactcaattaa
back to top
>KJ396616.1-SFB.m11125
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccttcgttcggtttct
gtgtacatgcaagtcatggagtgatttgattggaagctcaagttttggaagaacacaccttcataggaacgtcacaaaac
ttgcccatgtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccatatgatatagaa
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggctgtaagaatgatgcagaccaacaaagatgtcttctccgttgaggttta
tagtcgtagaacaaattcttggaggatgattgaaacaattcctccttggttaagaagcacttggcggcaacatcagggta
tattttttaatggagtagcataccatgtcattaacaaaagtcatacattcatcattatgtcattcgattatgccagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttctgtatcatcgtttacaacgaacaaatttg
cttggtttctggatattatgatggtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtacaatagggattagtatagataataaactctta
atgctaagaagaaatgacattagcggtatagcagatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaagtttggttttactca
attga
back to top
>KJ396615.1-SFB.m1993
atgatcctagtaagactacctgcaaaatccctcattcggtttctgtgtacatgcaagtcatggagtgatttgattggcag
ctcgagttttgttagcacgcaccttcataggaatgtcagaaaacatgcccatgtgtatctcctctgcctccaccacccaa
atgttagacgtcaggtggaccctgatgacccatatgttaaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtacttcaagttaagccatcccttagggagcccagaatattttgtgatatatggttcaagcaacggtttagtttg
catttcggatgagatattgaatttcgatagcccaatatacatatggaacccatcggttaggaaatttaggaccattccaa
tgagcaccaacatcaacattaaatttagctatgatgctctccaattcgggttccacccccggattaatgactacaaggct
gtaaggatgatgcgtaccaacaaaagtgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatcttaagggtacattttttggtggagtatcataccacatcattc
agaaaggtcctatattcagcattgtgtccttcgattcaggcagtgaagaattcgaagaattcatagcaccagacgccatt
tgccgtccatttgcgttatgtattgacgtctacaaggagcaaatttgtttgctttttagattttattcttgtgtggatga
ggacatggcaaaaaatgacttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcttgata
gctatggtacaatcgggattagtatagataatgaactcttattggaaagaagagattttattaggggcataggagatctg
tgtttgggtgattacgaatccaaacaagtttaa
back to top
>KJ396614.1-SFB.m11086
atgatcctagtaagactacctgcaaaatccctcattcggtttctgtgcacatgcaagtcatggagtgatttgaattgcag
ctcagcttttagcacgacactccataataggaatgtcagaaaacatgcccatgtttatctactctgcctccaccacccaa
atgttagacgtctggtcaaccgtgatgacccatatgttaaacaagaatttcaatggtctcttttttccaatgaaacattt
gaggagtacttcaagttaagccatcctttagggagcccagaatattttgtgatatatggttcaagcaacggtttagtttg
catttcggatgagatattgaatttcgatagcccaatatacatatggaacccatcggttaggaaatttaggaccattccaa
tgagcaccaacatcaacattaaatttagctatgatgctctccaattcgggttccacccccggattaatgactacaaggct
gtaaggatgatgcgtaccaacaaaagtgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccttggttaaaatgcacttggcagcatcttaagggtacattttttggtggagtatcataccacatcattc
agaaaggtcctatattcagcattgtgtccttcgattcaggcagtgaagaattcgaagaattcatagcaccagacgccatt
tgccgtccatttgcgttatgtattgacgtctacaaggagcaaatttgtttgctttttagattttattcttgtgtggatga
ggacatggcaaaaaatgacttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcttgata
gctatggtacaatcgggattagtatagataatgaactcttaatggaaagaagagattacgataagggcgtaggagatctg
catttgtgtaattacgaatccaagcaagttattgaaacaggaattgagttggccgtcatgaaatatggcgaaatggaatt
tttgtttgcaattacttacatagaaactttacccttactcaattaa
back to top
>KJ396613.1-SFB.m11128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtacaagcaagtcttggagtgaattgattggcagctcgagttttgttagcacacaccttcatagaaatgacacaaaac
atgcccacgtctatttactttggctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtcttttttttccatagaaacatttgagaagtgctttgagttaagacaccccttagggagcacagaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcgatcaggaaatttaggacccctccaatgagcaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccacccccgggttaatgactacaagattataagaatgatgcgtaccaacaaagatgccttcaccgttgaggt
ttatagtcttggaacagactcttggaagatgattgaagcaatcccgccctggttaaaatgcacttggcagcatcaaatgg
gtacattttttaatggtgtagcataccacatcattcagaaaggtcctatattcagcgttatctcattcgattcagacagt
gaagaattccaagaattcatagcaccagatgccatttgcagttcatgggggttatgtatcaacgtttacaaggaacaaat
ttgcttgctttttagattttatggttgtgaggaggagggcatggaacaagttgacttctgggttatacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>KJ396612.1-SFB.m11131
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccagttgtatatgctttgcttccaccacccaaatgttagacgtcataacgacactgatgacccatatgtcaaagaa
gaacttcagtggtcatttttttccaatgaaacctttgaggagttcttcaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaagggtttagtttgcatttcggatgagatattgaatttcgatagtcccatacacataa
ggaacccatcagttagtaaatttaagaaccctccaatgagcaacaaccttaaccttaaatttgcgtatggtgcttttcaa
ttcgggtttcaacccggggttaatgactacaagggcgttagagtggttggtaccaacaaagatgccttggcggtggaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaaatcctccctgggtaaaaagcacttggaaacctcatcagg
gtaccttttttaagggagtagcatatcacatcattgagaaaggtcctttattcagccttatgtcatttgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgctttttagattttattgttgtgagggagaaggcatggaaaaaaaggattggtgggttctgcaagaaaaccggt
ggaaacaatttcgtccttttatttatccttcggatgattgttatcgtacaatcgggattagtatagatagtaaaatctta
atggtaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacagg
aattaagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactca
atcattcttaa
back to top
>KJ396611.1-SFB.m11128
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttccgtatct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaactccataggattgtcacaaaac
atgcccatgtctatatgctctgcctccaccccccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcctttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattcttgtgaggagggcatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaattgtgtccttttatttatccttcggattattattatcgtacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacgttaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactcaatc
attcttaa
back to top
>KJ396610.1-SFB.m1996
atggacatcctagtaagactacctgcaaaatccctccttcggtttctgtgcacatgcaagtcatggtgtgatttgatcgc
aagctcaggttttatcagtacacaccttaatagggatgtcagaaaacatgcccatgtctgtctactttgcctacaccacc
caagttttgaacgtctggtcaaccgtgatgacccatatgtcaacaaagaatttcaatggtctcttttttccaatgaaaca
tttgaggagtacttcaagttaagccatcctttagggagcccagaatattttgtgatatatggttcaagcaacggtttagt
ttgcatttcggatgagatattgaatttcgatagcccaatatacatatggaacccatcggttaggaaatttaggaccattc
caatgagcaccaacatcaacattaaatttagttgtgttgctctccacttcgggttccacccccggattaatgactacaag
gctgtaaggatgatgcgtaccaacaaaagtgccttggcggttgaggtttatagtctcagaacagactcttggaagatgat
tgaagcaattcctccttggttaaaatgcacttggcagcatcttaagggtacattttttaatggagtagcgtaccacatca
ttcagaaaggtcctatcttcagcattgtgtccttcgattccggcagtgaagaattcgaagaattcatagcaccagacgcc
atttgccgtccatgtgcgttatgtattgatgtctacaaggagcaaatttgtttgctttttagattttattcttgtgtgga
tgaggacaaggcaaaaaatgagttatgggttctggaagaaaaacggtggaaacagttgtgtccttttatttatcctcatg
atagctatggtacaatcgggattagtatagataatgaactcttattggaaagaagagattttattaggggcataggagat
ctgtgtttgggtgattacgaatccaaacaagtttaa
back to top
>KJ396609.1-SFB.m11125
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacacaccttcataggaacgtcacaaaac
ttgcccatgtctatgtacttggcctccaccatccaaattttgaacgtcagaacgacactgatgacccatatgataaagac
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcctttagaagacacagaaca
ttatgggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcccatgagcaccaacaacattaagtatagctatgttgctctccaattc
gtgttgcatcccggggttagtgactacaaggctgtaagaatgatgcatgccaacaaagaagtattcgcggttgaggttta
tagtcttagaacaaattcttggaagatgaatgaaacaattcctccttgggtaagatgcacttggcagccacctcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatatattcagcattatgtcattcgattcaggcaggcaa
gaatttcaagaattcatagcaccagatgccattcgcagtttatgggggttgtgtatggacgttcacaaggaacaaattag
cttgctttctggatattatggttgggaggaggagggcatggacaaaattgacttatgggttgggcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtgcaatagggattagtatagataataaactctta
atgctcagaagaaatgacattagcggtattgctgatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaactttacccttactca
attga
back to top
>KJ396608.1-SFB.m11128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtacaagcaagtcttggagtgatttgattggcagctcgagttttgttaacacacaccttcatagaaatgacacaaaac
atgcccacgtctatctactttgcctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtctcttttttccaatgaaacatttgagaagtgctttgagttaagacaccccttagggagcacaaaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcgatcaggaaatttaggacccctccaatgagcaccaacattaacattaaagatagctatgttgctctccaa
ttcgggttccaccccggggttaatgactacgagattatgagaatgatgcgtaccaacgaagatgccttcgccgttgaggt
tcatagtcttgaaacagactcttggaagatgattgaaccactcccgccctggttaaaatgcacttgtcaccatcatatgg
gtacattttttaatgctgtagcataccatatcattcataaaggtcctatattcatcgttatctcattcgattcagacaga
gaagaattccacgaattcatagcaccagatgccatttgcatttcatgggggttatgtatcaacgtttacaaagaacaaat
ttgcttgctttttagattttatggtggggaggaggagggcatggaacaagttgacttctcggctctacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>KJ396607.1-SFB.m11131
atggcattcaccctacgtaagaaagaaatcttaatcgacgtcctagtaagactacctgcaaaatccgtcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaaaaggaatgtcacaaaac
acgcccaggtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccatatgatatagaa
gaacttcaatggtcacttttttccaatgaaacgtttgagcagttctccaatttaagccatcctttagaaaacacagagca
ttataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ttcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgccttggcagttgaagt
ttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcattataagg
gtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcatttgattcaggcagt
gaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtttacaatcaacaaat
ttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttctccaagaaaaacggt
ggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatagataataaactctta
atgcaaagaacagattacaatatgggcattgcagatctgcatttgtgtgattacgaatccaagcaagttcttgaaacaag
gattaagttggccctcgtgaaatatggcgaaatcgaatttgtgttttcaattacttacatagaaagtttggttttactca
ataattattaa
back to top
>KJ396606.1-SFB.m11128
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcatacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttatgctggggaggaggccatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaactgggtcctcttatttatcctccggaattattattacggacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactcaatc
attcttaa
back to top
>KJ396605.1-SFB.m11128
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgctcggtttct
ttgtacatgcaagtcatggagtgatgtgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggagacatcatcagg
gtacattttttaacggagtagcatatcacatcattgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattctggggaggagggcatggaaaaaattgacttatgggttctgcaagaaaacaggtgga
cacaattgtgtcgtttaatttatccttcggattattattatcgaacaatcggatttagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaagtttggttttactcaatc
attcttaa
back to top
>DQ646491.1-SFB.m11123
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacacaccttcataggaacgtcacaaaac
ttgcccatgtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccaaatgatatagaa
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggctgtaagaatgatgcataccaacaaagatgtcttcgcggttgaggttta
tagtcttagaacaaattcttggaagatgattgaaacaattcctccttggttaagatgcacttggcagcaacatcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatatattcagcattatgtcattcgattcaggcagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttctgtatcgacgtttacaaggaacaaatttg
cttgctttctggatattatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtacaatagggattagtatagataataaactctta
atgctaagaagaaatgacattagcggtatagcagatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaactttacccttactca
att
back to top
>DQ646490.1-SFB.m11120
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattcttgtgaggagggcatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaattgtgtccttttatttatccttcggattattattatcgtacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacaggaat
taagttggccaccgtgaaatatggcgaaatcgaattcttgttttcaattacttacatagaaactttactcttactcaatt
back to top
>DQ646489.1-SFB.m11091
acatcctagtaagactacctgcaaaatccctcgttcggtttctgtgtacaagcaagtcttggagtgatttgattggcagc
tcgagttttgttagcacacaccttcatagaaatgacacaatacatgcccacgtctatctactttgcctccacccctcaaa
ttttgaatgggcggtcgatcctgatgacccatatgttaaacaagaacttcaatggtctcttttctccaatgaaacatttg
agaagtgctttgagttaagacaccccttagggagcacagaacattatggaatatatggttcaagcaatggcttagtttgc
atttcggatgagatattgaatttcgatagtcctatacacatatggaatccatcgatcaggaaatttaggacccctccaat
gagcaccaacattaacattaaatatagctatgttgctctccaattcgggttccacccccgggttaatgactacaagatta
taagaatgatgcgtaccaacaaagatgccttcaccgttgaggtttatagtcttggaacagactcttggaagatgattgaa
gcaatcccgccctggttaaaatgcacttggcagcatcaaatgggtacattttctaatggtgtagcataccacatcattca
gaaaggtcctatattcagcgttatctcattcgattcagacagtgaagaattccaagaattcatagcaccagatgccattt
gcagttcatgggggttatgtatcaacgtttacaaggaacaaatttgcttgctttttagattttatggttgtgaggaggag
ggcatggaacaagttgacttctgggttctacaagaaaaacgatggaaccaattgtgtccttttatttatcctcggagctg
ttatcgtataatggggattagtataaataatgaactcatattgcaaaaacgagatctcaataagggcgtagcttatctat
atctctgtaattacaaatccaagcaagttcttgaaacaggaattacgttggctatcgtgacatatgacgatatcgaattc
ttgttttcaattacttacatacaaagcttggttttgctaaataattattaa
back to top
>DQ646488.1-SFB.m11094
acatcctagtaagactacctgcaaaatccgtcgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagc
tccagttttgttagcatacaccttaaaaggaatgtcacaaaacacgcccatgtctacttactctgcctccaccacccaaa
ttttgaacgccagaacgacaatgatgacccatatgatatagaagaacttcaatggtcacttttttccaatgaaacgtttg
agcagttctccaatttaggccatcctttagaaaacacagagcattataggatatatggttcaagcaatggtttagtttgc
atttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaagtttaagacccctccaat
gagcaccaacattaacatgaaattttcccatgttgctctccaattcgggttccaccccggggttaatgactacaagactg
taagaatgatgcgtaccaacaaaggtgccttggcagttgaagtttatagtctcagaacagactcttggaagatgattgaa
gcaattcctccttggttaaaatgcacttggcagcattataagggtacatttttcaatggagtagcataccacatcattaa
gaaaggtcctatattcagcgttatatcatttgattcaggcagtgaagaattcgaagaattcatagtaccagatgccatta
ccagttcatgggggttatgtattgacgtttacaatcaacaaatttgcttgcttcttaagttttattcttgtgaggaggag
ggcatggacaaaattgactcatgggttctccaagaaaaacggtggaaacaattgtgtccttttatttttcctttggatga
ttactattctacaatcgggattagtatagataataaactcttaatgcaaagaacagattacaatatgggcattgcagatc
tgcatttgtgtgattacgaatccaagcaagttcttgaaacaaggattaagttggccctcgtgaaatatggcgaaatcgaa
tttgtgttttcaattacttacatagaaagtttggttttactcaataattattaa
back to top
>DQ849118.1-SFB.m11131
atgacattcagactacataagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
gtgtacatgcaagtcatggagtgatttgcttggaagctcaagttttggcagcacacaccttcataggaacgtcacaaaac
ttgcccatgtctatctactttgcctccaccatccaaattttgaacgtcagaacgacactgatgacccaaatgatatagaa
caacttcaatggtcacttttttccaatgaaacatttgagcagttctccgagttaagccctcccttagaaaacaaagaaca
ttataggatatatggttcaagcaatggtttggtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaatttaggatccctcctataagcaccaacaacattaagtttagctatgttgctctccaattc
gggttccatcccggggttagtgactacaaggctgtaagaatgatgcataccaacaaagatgtcttcgcggttgaggttta
tagtcttagaacaaattcttggaagatgattgaaacaattcctccttggttaagatgcacttggcagcaacatcagggta
tattttttaatggagtagcataccatgttattaacaaaggtcatatattcagcattatgtcattcgattcaggcagtgaa
gaatttcaagaattcatagcaccagatgccatttgcagtttatgggggttctgtatcgacgtttacaaggaacaaatttg
cttgctttctggatattatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggtgga
aacaattatgtccttttacttatcctttggattattattattatcgtacaatagggattagtatagataataaactctta
atgctaagaagaaatgacattagcggtatagcagatctgcatttgtgtgattacgaatccaagcaagttcttaaaacagg
aattaagctggccaccatgaaatatggcgaaatggaattcttgttttctattacttacatagaaagtttggttttactca
attattattaa
back to top
>DQ849090.1-SFB.m11041
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatcccttattcggtttct
gtgtacatgcaagtcatggagtgatttgattggaagctcaatttttgttggcacacacctttgtaggaatgtgacaaaac
atacccatgtttatctactctgtctccaccacccaaattttgaacgtttggtcgaccctaatgacccatatcttaaaaag
gaatttcaatggtctttttttcccaatgaaacatttgaggagtgctacaaactaagacatcccttagggatcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttctgatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaaattaggacccctccaatgagcaccaacattaacatcaaatttagctcttttgctctccaa
ttcgggttccaccccggggttaatgactacaaggctgtaaggatgttgcgtaccaacaaaaatgccttggctgttgaggt
ttatagtcttagaacagactgttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gcacattttttaatggagtagcataccacatcatccagaagggtcctctattcagcattatgtcgttcgactcaggcagt
gaagaattccaagaattcatagcaccagatgcaatttgccgtccatctgagttatgtattgacgtttacaaggaacaaat
ttgcttgctttttggattttatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatgtttcctttggatcgttgtcaccgaacaatcagtattagtgcagataatgaactctta
atggaaagaagagatttcattaagggcataacatatctgtgtttgtgtaattacgaatccaagcaagttcttgaaacagg
a
back to top
>DQ849089.1-SFB.m1972
ctcattcggtttctgtgcacatgcaagtcatggtgtgatttgattggcagctcaggttttatcagtacacaccttaatag
gaatgtcagaaaacatgcccatgtctgtctactttgcctacaccacccaagttttgaacgtctggtcaaccgtgatgacc
catatgttaaaaaagaatttcaatggtctcttttttccaatgaaacatttgaggagtgctacaagttaagccatccctta
gggagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaggaaatttaagacccctccaatcagcaacaacattaacattaaatttagtt
gtgttgctctccacttcgggttccaccccggggttaatgactacaaggctgtaaggatgctgcgtaccaacaaagatgcc
tttgcagttgaggtttatagtcttggaacgaactgttggaagatgattgaagcaatacctgcttggttaaaatgcacttg
gcggcatcatgatcgtacattttttaatggagtagcgtaccacatcattgagaaaggtcctatattcagcattatgtcat
tcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatttgcaatccatgtacgttatgtattgatgtt
tacaaggaacaaatttgcttgctttttagcttttattcttgtgaggaggaggacatgggaaaaagggacttatgggttct
ccgagaaaaacggtggaaacaattgtgtccttttatttatccttttgatggttatgatacaatcgggattagtatagata
atgaactcttaatggaaagaagagattacgataagggcgtagcagatctgcatttgtgtaattacgaatccaagcaagtt
attgaaacagga
back to top
>DQ849088.1-SFB.m1978
gtcgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaaaag
gaatgtcacaaaacacgcccatgtctacttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacc
catatgatatagaagaacttcaatggtcacttttttccaatgaaacgtttgagcagttctccaatttaagccatccttta
gaaaacacagagcattataggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaggaagtttaagacccctccaatgagcaccaacattaacatgaaattttccc
atgttgctctccaattcgggttccaccccggggttaatgactacaagactgtaagaatgatgcgtaccaacaaaggtgcc
ttggcagttgaagtttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttg
gcagcattataagggtacatttttcaatggagtagcataccacatcattaagaaaggtcctatattcagcgttatatcat
ttgattcaggcagtgaagaattcgaagaattcatagtaccagatgccattaccagttcatgggggttatgtattgacgtt
tacaatcaacaaatttgcttgcttcttaagttttattcttgtgaggaggagggcatggacaaaattgactcatgggttct
ccaagaaaaacggtggaaacaattgtgtccttttatttttcctttggatgattactattctacaatcgggattagtatag
ataataaactcttaatgcaaagaacagattacaatatgggcattgcagatctgcatttgtgtgattacgaatccaagcaa
gttcttgaaacaaggatt
back to top
>DQ849087.1-SFB.m1977
ctcgttcggtttctgtgtacatccaagtcatggagtgatttgattggcggctcgagttttgttagcgcacaccttaatag
gaatgccacaaaacatgcccatgtctgtctactttgtctccaccacccaaattttgaacgtctggtcaaccgtgatgacc
catattttaaaaaagaatttcaatggtctctttattccaatgaaacatttgaggagttctccaagttaagccatcccgta
gggagcacagaacattatgtgatatatggctcaagcaatggtttagtttgcatatccgatgagatactgaatttcgatag
tcctatatacatatggaacccatcagttaggaaatttaggaccactccaatgagcaccaacattaacattaaatttagct
atgttgctctccaattcgggttccacccccgggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgcc
ttggcggttgaggtttatagtctcagaacagactcttggaagatgattgaagcaattcctccgtggttaaaatgcacttg
gcagcattataagggtacattttttgacggagtagcatatcacgtcattcagaaaggtcctatattcagcattttgtcct
tcaattcaggcaatgaagaattcgaagaatttatagcaccagatgccatttgcggtacatttgggttatgtatcgacatt
tacaaggaacaaatttgtttgctttttagatgttatggttgtgaggaggagggcatgaacaaagttgacttatgggttct
gcaagaaaaacggtggaaacaattgtgtccttttatttttccattggatgaatggagtggtgcaatcgggattagtatag
atgatgaactcttaatggcaataacagatttcgataagggcgtagcagatctatatttgtgtaattacgaatgccaggat
gttcttgaaacaggaat
back to top
>DQ849086.1-SFB.m11036
atgacattcacaccacgtaagaaaaaaatcttgatcgacatcctagcaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacacctccataggaatgtcacaaaac
atgcccatgtctatatgctctgcctccaccacccaaattttgaacgtcataacgacactgatgacccatatgacatagaa
gaacttcagtggtcacttttttccaatgaaacgttcgagcagttctccaagttaagccatcccttaggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcaattagtaaatttaggacccctccaatgagcaccaacattaaccttaaatttgcctatgttgctctccaa
ttcgggttccaccctggggttaatgactacaaggctgtaagaatgatgcgtaccaacaaagatgctttcgcggttgaggt
ttatagtcttcaaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggaaacatcatcagg
gtacattttttaacggagtagcatatcacatcatcgagaaaggtcctctattcagcattatgtcattcgattcaggcagt
gaagaattcaaagaattcatagcaccagatgccatttgcagtccatctgacttatgtattgacgtttacaaggaacaaat
ttgcttgcttcttatgttttattcttgtgaggagggcatggaaaaaattgacttatgggttctgcaagaaaaccggtgga
aacaattgtgtccttttatttatccttcggattattattatcgtacaatcgggattagtatagatagtaaaatcttaatg
ctaagagcagatcacattaggggcatattagatatgcatttgtgtgattgcgaatccaagaaagttcttgaaacag
back to top
>DQ849085.1-SFB.m1975
gttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcatacaccttaacaggaa
tgtcacaaaacatgtccatgtctatttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacccat
atgataaagaagaacttcaatggtcactttttgccaatgaaacgtttaagcatttctccaatttaagccatcccttagaa
agcacagagcattatatgatatatggttcaagcaatggtttagtttgtatttcggatgagataatgaatttcgatagtcc
tatatacatatggaacccatcggttaggaaatttaggaccactcaaatgagcaccaacattaacattaaattttcccatg
ttgctctccaattcgggttccaccctggggttaatgactacaaggctgtaaggatgatgcgaaccaacaaaggtgccttt
gtagtggaggtttatagtctcagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggca
gcagcttaagggtacattttttaatggagtagcataccacattattgagaaaggtcctataatcagcgttatatcattcg
attcaggcagcgaaaaattcgaagaattcatagcaccagatgccatttgcgatacatgggggttatgtattgacatgtac
agggaacaaatttgcttgctttgtagatgttatgggtgcgaggaggagggcatggaaaaagtggacttatgggttctgca
agaaaaacggtggaaacaattgtgtccttttacttttcctttggatgaatggaatgttacaatcgggattactaaagatt
atgaactcttaatggaaataagagatttcgataatggcgtggcagatctgtatttgtgtaattacgactccaaggaagtt
cttaaaacaggaata
back to top
>DQ849084.1-SFB.m11128
atgactgtcagactacgtaagaaagaaatcttaatcgacatcctagtaagattacctgcaaaatccctcgttcggtttct
gtgtactagcaagtcttggagtgatttgattggcagctcgagttttgttagcacacaccttcatagaaatgacacaatac
atgcccacgtctatctactttgcctccacccctcaaattttgaatgggcggtcgatcctgatgacccatatgttaaacaa
gaacttcaatggtctcttttctccaatgaaacatttgagaagtgctttgagttaagacaccccttagggagcacagaaca
ttatggaatatatggttcaagcaatggcttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaatccatcgatcaggaaatttaggacccctccaatgagtaccaacattaacattaaatatagctatgttgctctccaa
ttcgggttccacccccgggttaatgactacaagattataagaatgatgcgtaccaacaaagatgccttcaccgttgaggt
ttatagtcttggaacagactcttggaagatgattgaagcaatcccgccctggttaaaatgcacttggcagcatcaaatgg
gtacattttctaatggtgtagcataccacatcattcagaaaggtcctatattcagcgttatctcattcgattcagacagt
gaagaattccaagaattcatagcaccagatgccatttgcagttcatgggggttatgtatcaacgtttacaaggaacaaat
ttgcttgctttttagattttatggttgtgaggaggagggcatggaacaagttgacttctgggttctacaagaaaaacgat
ggaaccaattgtgtccttttatttatcctcggagctgttatcgtataatggggattagtataaataatgaactcatattg
caaaaacgagatctcaataagggcgtagcttatctatatctctgtaattacaaatccaagcaagttcttgaaacaggaat
tacgttggctatcgtgacatatgacgatatcgaattcttgttttcaattacttacatacaaagcttggttttgctaaata
attattaa
back to top
>AM746963.1-SFB.m1992
gacatcctagcaagactaactgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtgatttgattggcag
ctcaagttttgttagcacacacctaaacaggaatgccacaaaacatgcccatctctatctactctgcctccaccactcaa
attttgaacgtcaggctgatcctgatgacccgtatgtcaaacaagaatttcaatggtctcttttttcgaatgaaacattt
gaggagtgctccaagttaagccatcccttagggagcacagaaccttatgtgatttatggctcaagccatggtttagtttg
catttccgatgagataatgaatttcgatagtcccatacacatatggaacccgtcggttaagaaatttaagacccttccaa
taagcaccaatattaacattaaatttagccatgttgctctccaattcgggttccaccccggggttaatgattacaaggct
ataaggatgttgcgtaccaacaaaaatgccttggtggttgaggtttatagtctcagagcagactcttggatgatgattga
agcaattcctccttggttaaaatgcacttggcagcatcatgacggtacattctttaatggagtggcataccacatcattg
aaaaaggtcctatattcagtattatatccttcgattcaggcagtgaagaattcgaggaattcatagcaccggatgccatt
tgcagttcgtggcgattatgcatccacgtttacaaggaacaaatttgcttgtttttcggattttatggttgtgaggaggg
catggaaaaaattgacttatggggtctgcaaaaaaaacggtggaaaaaattgtgtccttttatttatgatccttttgatt
attgttatcgtataattgggattagtatagataatgaactcttaatgggaagagaaggttttgctaagggtgtagcagat
ctggaattgtggaattacgaatccaaacaggt
back to top
>AM746962.1-SFB.m1992
gacatcctagcaagactgccagtaaaatccctggttcggtttctgtgcacatgcaagtcatggagtgatttgattggcag
ctccagtttagttagcacacatcttcataggaatgtcacaaagcatgaccatgtctatttactttgtctccaccactcaa
attttgaacttcaggctgaccctgatgacccatatgttaaacaagaatttcaatggtcccttttttccaatcagacattt
gagcagtgctccaagttaagccatcccttagggagcacagaacattatgtgatatatggctcaagcaatggtttagtttg
tatttcggatgagatattgaatttcgatactcctatatacatatggaacccatcggttaggaaacttaggacccttccaa
tcagcaccaacattaacattaaatttagtcatgttgctctccaattcgggtttcaccccgtggttaatgactacaaggct
gtaaggatgatgcgcacgaacaaaaatcccttggcggttgaggtttatagtcttagaacagactcttggaaaatgattga
agtaattccaccttggttaaaatgcacttggaaacatcataagggtacatttcttaatggagtagcataccacatgattc
agaaaggtcctatattcagcattgtgtcgtttgattcaggcagtgaagaattccaagaattcatagcaccagatgccatt
tgcaatccatgtgagttggtacgtattgacgtttacaaggaacaaatttgcttgctttgtagcttgtatccttcttctga
ggatggcatgggaaaaaatgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttgtttatcctcttg
attgcgatggtacaatagggattagtatagataatgaactcttaatggaaaaaagagatttcgataggggcatagcaaat
gtgcatttgtgtaattacgaatccaaacaggt
back to top
>AM746961.1-SFB.m1992
gacatcctagtaagactgccagcaaaatccctcgttcggtttctgtgtacatccaagtcatggagtgatttgattggcgg
ctcgagttttgttagcgcacaccttaataggaatgccacaaaacatgcccatgtctgtctactttgtctccaccacccaa
attttgaacgtctggtcaaccgtgatgacccatattttaaaaaagaatttcaatggtctctttattccaatgaaacattt
gaggagttctccaagttaagccatcccgtagggagcacagaacattatgtgatatatggctcaagcaatggtttagtttg
catatccgatgagatactgaatttcgatagtcctatatacatatggaacccatcagttaggaaatttaggaccactccaa
tgagcaccaacattaacattaaatttagctatgttgctctccaattcgggttccacccccgggttaatgactacaaggct
gtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttggaagatgattga
agcaattcctccgtggttaaaatgcacttggcagcattataagggtacattttttgacggagtagcatatcacgtcattc
agaaaggtcctatattcagcattttgtccttcaattcaggcaatgaagaattcgaagaatttatagcaccagatgccatt
tgcggtacatttgggttatgtatcgacatttacaaggaacaaatttgtttgctttttagatgttatggttgtgaggagga
gggcatgaacaaagttgacttatgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttttccattggatg
aatggagtggtgcaatcgggattagtatagatgatgaactcttaatggcaataacagatttcgataagggcgtagcagat
ctatatttggggaattacgaatccaaacaagt
back to top
>DQ992485.1-SFB.m11083
atcctagtaagactacctgcaaagtccctcgttcggtttctttgcacatgcaagtcatggagtgatttgattggcagctc
gagttttgttagcatacacgttaacaggaatgtcacaaaacatgcccatgcccatttactctgcctccaccacccaaatt
ttgaacgccagaacgacaatgatgacccatatgatatagaagaacttcaatggtcgcttttttccaatgaaacgtttgag
cagttctccaagttgagccatcccttagaaagcacagagcagtataggatatatggttcaagcaatggtttagtttgctt
ttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaggacccctccaatga
gcaccaacattaacatcaaattttcctatgttgctctccaattcgggttccaccccagggttaatgactacaaggctgta
aggatgatgcgtaccaacaaaggtgccttggcagttgaggtatatagtcttagaacagactcatggaaaatgattgaaac
aattcctccttggttaatatgcacttggcagcatcataagggtacattttttaatggagtagcataccacgtcattcaga
aaggtcctatattgagtattatgtcattcgattcaagcagtgaagaattcgaagaattcatagcaccagatgccatttgc
agttcctggaagttatgtatcaacatttacaaggaacaggtttgcttgctttttggattttatggttgtgaagaggaagg
catggaaaaaattgacttatgggttctagaagaaaaacggtggaaacaactgtgtccttttatttatcctggggattatt
gttataatgtggtcgggattagtatagataatgaactcttaatggcaagaggaggcttcgatatgggcatagcagatctg
tatttgtgtaattacaaatccaagaaagttattgaaacaggaattaaattggccgtcaaggaatatggcgaaatcgaatt
cttgtttgcaattacttacctagaaactttaccattactcaat
back to top
>DQ989579.1-SFB.m11084
atcctagtaagactacctgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtgatttgattggcagctc
aagttttgttagcacacacctaaacaggaatgccacaaaacatgcccatctctatctactctgcctccaccactcaaatt
ttgaacgtcaggctgatcctgatgacccgtatgtcaaacaagaatttcaatggtctcttttttcgaatgaaacatttgag
gagtgctccaagttaagccatcccttagggagcacagaaccttatgtgatttatggctcaagccatggtttagtttgcat
ttccgatgagataatgaatttcgatagtcccatacacatatggaacccgtcggttaagaaatttaagacccttccaataa
gcaccaatattaacattaaatttagccatgttgctctccaattcgggttccaccccggggttaatgattacaaggctata
aggatgttgcgtaccaacaaaaatgccttggtggttgaggtttatagtctcagagcagactcttggatgatgattgaagc
aattcctccttggttaaaatgcacttggcagcatcatgacggtacattctttaatggagtggcataccacatcattgaaa
aaggtcctatattcagtattatatccttcgattcaggcagtgaagaattcgaagaattcatagcaccggatgccatttgc
agttcgtggcgattatgcatccacgtttacaaggaacaaatttgcttgtttttcggattttatggttgtgaggagggcat
ggaaaaaattgacttatggggtctgcaaaaaaaacggtggaaaaaattgtgtccttttatttatgatcctttagattatt
gttatcgtataattgggattagtatagataatgaactcttaatgggaagagaaggttttgctaagggtgtagcagatctg
gaattgtgcaattacgaatccaagcttatacgtgaaacaggaattaagttgggcatcatgacatatgcggaaatcgaatt
cttgttttcgattacttacgtagaaactttacctcttctcaatt
back to top
>DQ989578.1-SFB.m11081
atcctagtaagactacctgcaaaatccctcattcggtttctgtgcacatgcaagtcatggtgtgatttgattggcagctc
aggttttatcagtacacaccttaataggaatgtcagaaaacatgcccatgtctgtctactttgcctacaccacccaagtt
ttgaacgtctggtcaaccgtgatgacccatatgttaaaaaagaatttcaatggtctcttttttccaatgaaacatttgag
gagtgctacaagttaagccatcccttagggagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcat
ttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggttaggaaatttaagacccctccaatca
gcaacaacattaacattaaatttagttgtgttgctctccacttcgggttccaccccggggttaatgactacaaggctgta
aggatgctgcgtaccaacaaagatgcctttgcagttgaggtttatagtcttggaacgaactgttggaagatgattgaagc
aatacctgcttggttaaaatgcacttggcggcatcatgatcgtacattttttaatggagtagcgtaccacatcattgaga
aaggtcctatattcagcattatgtcattcgattcaggcagtgaagaattcgaagaattcatagcaccagatgccatttgc
aatccatgtacgttatgtattgatgtttacaaggaacaaatttgcttgctttttagcttttattcttgtgaggaggagga
catgggaaaaagggacttatgggttctccgagaaaaacggtggaaacaattgtgtccttttatttatccttttgatggtt
atgatacaatcgggattagtatagataatgaactcttaatggaaagaagagattacgataagggcgtagcagatctgcat
ttgtgtaattacgaatccaagcaagttattgaaacaggaattgagttggccgtcatgaaatatggcgaaatggaattttt
gtttgcaattacttacatagaaactttacccttactcaatt
back to top
>EF490571.1-SFB.m1976
ctcgttcggtttctttgcacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcatacacgttaacag
gaatgtcacaaaacatgcccatgcccatttactctgcctccaccacccaaattttgaacgccagaacgacaatgatgacc
catatgatatagaagaacttcaatggtcgcttttttccaatgaaacgtttgagcagttctccaagttgagccatccctta
gaaagcacagagcagtataggatatatggttcaagcaatggtttagtttgcttttcggatgagatattgaatttcgatag
tcctatacacatatggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacatcaaattttcct
atgttgctctccaattcgggttccaccccagggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaggtgcc
ttggcagttgaggtatatagtcttagaacagactcatggaaaatgattgaaacaattcctccttggttaatatgcacttg
gcagcatcataagggtacattttttaatggagtagcataccacgtcattcagaaaggtcctatattgagtattatgtcat
tcgattcaagcagtgaagaattcgaagaattcatagcaccagatgccatttgcagttcctggaagttatgtatcaacatt
tacaaggaacaggtttgcttgctttttggattttatggttgtgaagaggaaggcatggaaaaaattgacttatgggttct
agaagaaaaacggtggaaacaactgtgtccttttatttatcctggggattattgttataatgtggtcgggattagtatag
ataatgaactcttaatggcaagaggaggcttcgatatgggcatagcagatctgtatttgtgtaattacaaatccaagaaa
gttattgaaacaggaa
back to top