SFB, SFB (gene) Prunus speciosa

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus speciosa
Synonym S-haplotype-specific F-box protein
Description NA
Comment associated with self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBHM347511.1-SFBPrunus speciosagene
SFBHM347510.1-SFBPrunus speciosagene
SFBHM347509.1-SFBPrunus speciosagene
SFBHM347508.1-SFBPrunus speciosagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBHM347511.1-SFB.m1Prunus speciosamRNA
SFBHM347510.1-SFB.m1Prunus speciosamRNA
SFBHM347509.1-SFB.m1Prunus speciosamRNA
SFBHM347508.1-SFB.m1Prunus speciosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus speciosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM347511.1-SFB N/A HM347511.1
gene parsed from NCBI nr database HM347510.1-SFB N/A HM347510.1
gene parsed from NCBI nr database HM347509.1-SFB N/A HM347509.1
gene parsed from NCBI nr database HM347508.1-SFB N/A HM347508.1
mRNA parsed from NCBI nr database HM347511.1-SFB.m1 N/A HM347511.1
mRNA parsed from NCBI nr database HM347510.1-SFB.m1 N/A HM347510.1
mRNA parsed from NCBI nr database HM347509.1-SFB.m1 N/A HM347509.1
mRNA parsed from NCBI nr database HM347508.1-SFB.m1 N/A HM347508.1

Sequence(s):
>HM347511.1-SFB1125
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcacacaccttcgtaggaatgtcacaaaga
atacccatgtctatctactctgccttcatcacccgaattttgaacgtttggtcgaccccaatgacccatatgttaaaaag
gaatatcagtggtctcttttttgcaatgagacatttgagcagtcctccaagttaagccatcccttagggagcacagatca
ttatggaatatacggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcagttaggaaacctaggacccctccaatcagcaccaacattaacattaaattttcctatgtttctctccaa
ttcgggttccaccctggggttaatgactacaaggctgttaggatgatgcgtaccaacaaaaatgccttggcggtggaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcacaagg
gtacattttttaacggagtagcatatcacctcattgagaaatatcctatattcagcattgtgtcattcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcggtttattgggggtatgtattgacgtttacaaggaacaaat
ttgcttgattttcgactgttatccttgtgaggaggagggcatggacaagattgacttatgggttctacaagaaaaacggt
ggaaacaattgtgcccttttatttatccttcgggttatgagtatcgtacaatcgggattactatggataataaattctta
atgcaaaaagaagattacattgggggcatagtagatctgcatttgtgtgattacgaatccaaggacgttcttgaaacagg
aattaagttggccatcatgaaatatggcgaaattgaatttgtattttcaattacttgcgtagaaagtttggttctactga
attaa
back to top
>HM347510.1-SFB1128
atgacactcacactacgtaagaaagaaatcttaaccgatatcctagtaagactacctgcaaaatccctcattcggttttt
gtgtacatgcaagtcatggagtgatttgattggaagctcaagttttgttagcacacaccttcataggaatgtcacaaaac
atgcccatgtctgtctgctctgcctccaccacccaaattttgaatgtcagaacgacgatgatgacccatttgttaaagaa
gaacttcaatggtcacttttttacaatgaaacatttgagcagtgcttcaagttaaaccatcccctgggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgtatttcggatgagatattgaattatgatagtcctatacacatat
ggaacccatcggtcaggaaatttaggacccctccagtgagcaccaacattaatattaaatttggctatgttgctctccag
tttggcttccaccccaggattaatgactacaaggctatcagaatgatgcgtaccaacaaaggtgccttcgcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataacg
gtacatttttcaatggagtagcatacaacatcattcagaaaggtcctatattcagcattatttcctttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgctatttgcatttcacaggggttatgcatcgaggtttacaaggaacaaat
ttgcttgctttttagctgttatggttgcgaggaggagggcatggacaaaaatgacttctgggttctgcaagaaaaacgtt
ggaaacaattgtgtccatttatttttccttcgaagagttatagtacaatggggattagtatagataatgaactcttaatg
caaagaagagatttctttaacggcggagcaaatctgtgtttgtgtaattacgactccaagcaagttcttgaaacaggaat
caagttggcctgcatgacatatggggaaatcgaattcttgttttcatttacttacatagaaagtttggttttactcaatg
actattaa
back to top
>HM347509.1-SFB1122
atgacattcacactacgtaagaaagagattttagtcgacatcctaataagacttcctgcaaaatcactcgttcgatttct
gtgtacatgcaaattatggagtgatttgataagcagctcgagttttgttagcacacacctaaacaggaatgtcacaaaac
attcccatgtctatttactttgtttccaccacccaaattttgaatgtttggtcgaccctgatgatccaggttttgaacaa
gaacttcaatggtctcttttttcatatgaaacatttgagcactgctccgagttaagccatcccttagggagcccagaacc
ttatcggatatatggttcaactaacggtttaatttgcatttcggatgcgatattgaattcagggagtcctatacacatat
ggaacccatcggttaggaaagttattaggaccctcccaatgagcaccaacaacattgaattaagctacattgatctccac
ttcgggttccaccccggggttaatgactacaaggccgtacgaatgatgcgtattgacaaagatgccttcgcggttgaggt
ttatagtctcagcactgattcttggaagctgattgaagcaattcctccttggttaaaatgcgattggcaacattataaag
ggacattttttaatggagtagtataccacttaattgagaaaggtcctacattcagcgttatgtccttcgattcaggcaat
gaagaattcgaagaattcatagccccaggtgacatttgcaattcacggtggttatgtattgacgtctaccagaaacaaat
ttgcttgctttttgacttttatggttgtgaggaggagggcatggaaaaaactgacttatgggttctaaaagaaaaacagt
ggaaacagttgcatccttttatttatcctacggactcttgtcatggaatggggatcagtatacataatgaacttttaatg
agaaaagatgacttcaatggaggcctagcagatctgtatttgtgtaattatgaatccacacaggttcgtgaaacaggaat
taagttggccgttatgaaatatggccggcgggaacaagtgtttgcaactacttacatagaaagcttggtgttactcaagt
aa
back to top
>HM347508.1-SFB1131
atgacattcacactacgtaagaacgagatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
atgtacatgcaagtcatggagtgttttgattggcagctcgagttttgtcagtacacactttcataggaataccacaaaac
atgcccatgcctatacactctgcctccaccacccaaatgttgaacgtcaagccgaccctgatgatccatatgttaaacaa
gaatttcaatggtctcttttttccaacgaaacatttgaggagtgctccaagttaagccatcccttagggagcagagaaca
ttatatggtatatggctcaagcaatggtttagtttgtctttcggatgagattctgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacttcaatgagcaccaacattaacattaaatttagccatgttgctcttcaa
ttcgggttccacccccgggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggtggaggt
ttatagtctcagaacagactcttggaagatgattgaaggaattccaccatggttaaaatgcagttggcagccttataagg
gtacattttttaagggagtagcataccacgtcattctgaaaggtcctatgttcagcatcatgtcgttcgattcaggcagt
gaagaattcgaagaatttatagcaccagatgccatttgcgatacatggggcttatgtatcgacatttacaaggaacaaat
ttgcttgcttttaagatgttatggttgtgaggaggagggcatgaacaaagttgatttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttttcctttagatgaatggaatggaacaatcggtattagtatagatgatgaactctta
ttggaaataacagatttcggtaagggcgtagcagatctgtatttgtgtacttacgaatccaaggaagttcatgaaacagg
agttaagttggccgtcatgaaatatgacgaaatcgaattcttgttcgcaattacttacatagaaagtttggttttactca
atgactattaa
back to top
>HM347511.1-SFB.m11125
atgacattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctccagttttgttagcacacaccttcgtaggaatgtcacaaaga
atacccatgtctatctactctgccttcatcacccgaattttgaacgtttggtcgaccccaatgacccatatgttaaaaag
gaatatcagtggtctcttttttgcaatgagacatttgagcagtcctccaagttaagccatcccttagggagcacagatca
ttatggaatatacggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcagttaggaaacctaggacccctccaatcagcaccaacattaacattaaattttcctatgtttctctccaa
ttcgggttccaccctggggttaatgactacaaggctgttaggatgatgcgtaccaacaaaaatgccttggcggtggaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcacaagg
gtacattttttaacggagtagcatatcacctcattgagaaatatcctatattcagcattgtgtcattcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcggtttattgggggtatgtattgacgtttacaaggaacaaat
ttgcttgattttcgactgttatccttgtgaggaggagggcatggacaagattgacttatgggttctacaagaaaaacggt
ggaaacaattgtgcccttttatttatccttcgggttatgagtatcgtacaatcgggattactatggataataaattctta
atgcaaaaagaagattacattgggggcatagtagatctgcatttgtgtgattacgaatccaaggacgttcttgaaacagg
aattaagttggccatcatgaaatatggcgaaattgaatttgtattttcaattacttgcgtagaaagtttggttctactga
attaa
back to top
>HM347510.1-SFB.m11128
atgacactcacactacgtaagaaagaaatcttaaccgatatcctagtaagactacctgcaaaatccctcattcggttttt
gtgtacatgcaagtcatggagtgatttgattggaagctcaagttttgttagcacacaccttcataggaatgtcacaaaac
atgcccatgtctgtctgctctgcctccaccacccaaattttgaatgtcagaacgacgatgatgacccatttgttaaagaa
gaacttcaatggtcacttttttacaatgaaacatttgagcagtgcttcaagttaaaccatcccctgggaagcacagaaca
ttatggggtatatggttcaagcaatggtttagtttgtatttcggatgagatattgaattatgatagtcctatacacatat
ggaacccatcggtcaggaaatttaggacccctccagtgagcaccaacattaatattaaatttggctatgttgctctccag
tttggcttccaccccaggattaatgactacaaggctatcagaatgatgcgtaccaacaaaggtgccttcgcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataacg
gtacatttttcaatggagtagcatacaacatcattcagaaaggtcctatattcagcattatttcctttgattcaggcagt
gaagaattcgaagaattcatagcaccagatgctatttgcatttcacaggggttatgcatcgaggtttacaaggaacaaat
ttgcttgctttttagctgttatggttgcgaggaggagggcatggacaaaaatgacttctgggttctgcaagaaaaacgtt
ggaaacaattgtgtccatttatttttccttcgaagagttatagtacaatggggattagtatagataatgaactcttaatg
caaagaagagatttctttaacggcggagcaaatctgtgtttgtgtaattacgactccaagcaagttcttgaaacaggaat
caagttggcctgcatgacatatggggaaatcgaattcttgttttcatttacttacatagaaagtttggttttactcaatg
actattaa
back to top
>HM347509.1-SFB.m11122
atgacattcacactacgtaagaaagagattttagtcgacatcctaataagacttcctgcaaaatcactcgttcgatttct
gtgtacatgcaaattatggagtgatttgataagcagctcgagttttgttagcacacacctaaacaggaatgtcacaaaac
attcccatgtctatttactttgtttccaccacccaaattttgaatgtttggtcgaccctgatgatccaggttttgaacaa
gaacttcaatggtctcttttttcatatgaaacatttgagcactgctccgagttaagccatcccttagggagcccagaacc
ttatcggatatatggttcaactaacggtttaatttgcatttcggatgcgatattgaattcagggagtcctatacacatat
ggaacccatcggttaggaaagttattaggaccctcccaatgagcaccaacaacattgaattaagctacattgatctccac
ttcgggttccaccccggggttaatgactacaaggccgtacgaatgatgcgtattgacaaagatgccttcgcggttgaggt
ttatagtctcagcactgattcttggaagctgattgaagcaattcctccttggttaaaatgcgattggcaacattataaag
ggacattttttaatggagtagtataccacttaattgagaaaggtcctacattcagcgttatgtccttcgattcaggcaat
gaagaattcgaagaattcatagccccaggtgacatttgcaattcacggtggttatgtattgacgtctaccagaaacaaat
ttgcttgctttttgacttttatggttgtgaggaggagggcatggaaaaaactgacttatgggttctaaaagaaaaacagt
ggaaacagttgcatccttttatttatcctacggactcttgtcatggaatggggatcagtatacataatgaacttttaatg
agaaaagatgacttcaatggaggcctagcagatctgtatttgtgtaattatgaatccacacaggttcgtgaaacaggaat
taagttggccgttatgaaatatggccggcgggaacaagtgtttgcaactacttacatagaaagcttggtgttactcaagt
aa
back to top
>HM347508.1-SFB.m11131
atgacattcacactacgtaagaacgagatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttct
atgtacatgcaagtcatggagtgttttgattggcagctcgagttttgtcagtacacactttcataggaataccacaaaac
atgcccatgcctatacactctgcctccaccacccaaatgttgaacgtcaagccgaccctgatgatccatatgttaaacaa
gaatttcaatggtctcttttttccaacgaaacatttgaggagtgctccaagttaagccatcccttagggagcagagaaca
ttatatggtatatggctcaagcaatggtttagtttgtctttcggatgagattctgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacttcaatgagcaccaacattaacattaaatttagccatgttgctcttcaa
ttcgggttccacccccgggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggtggaggt
ttatagtctcagaacagactcttggaagatgattgaaggaattccaccatggttaaaatgcagttggcagccttataagg
gtacattttttaagggagtagcataccacgtcattctgaaaggtcctatgttcagcatcatgtcgttcgattcaggcagt
gaagaattcgaagaatttatagcaccagatgccatttgcgatacatggggcttatgtatcgacatttacaaggaacaaat
ttgcttgcttttaagatgttatggttgtgaggaggagggcatgaacaaagttgatttatgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttttcctttagatgaatggaatggaacaatcggtattagtatagatgatgaactctta
ttggaaataacagatttcggtaagggcgtagcagatctgtatttgtgtacttacgaatccaaggaagttcatgaaacagg
agttaagttggccgtcatgaaatatgacgaaatcgaattcttgttcgcaattacttacatagaaagtttggttttactca
atgactattaa
back to top