SFB, SFB (gene) Prunus tenella

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus tenella
Synonym S-locus F-box protein
S8_SFB
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBDQ983369.1-SFBPrunus tenellagene
SFBDQ983368.1-SFBPrunus tenellagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBDQ983369.1-SFB.m1Prunus tenellamRNA
SFBDQ983368.1-SFB.m2Prunus tenellamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus tenellagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ983369.1-SFB N/A DQ983369.1
gene parsed from NCBI nr database DQ983368.1-SFB N/A DQ983368.1
mRNA parsed from NCBI nr database DQ983369.1-SFB.m1 N/A DQ983369.1
mRNA parsed from NCBI nr database DQ983368.1-SFB.m2 N/A DQ983368.1

Sequence(s):
>DQ983369.1-SFB1092
atgacatttacaatacgtaagaaagaaatcttaatcgacatcctagtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaacggtttagtttgcatttcggatgagatactgaatttcgatagttctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagaaattccaccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcatcgagaaaggtcctataatcagcattatgtcattcaattcaggcagt
gaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcggggtctacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaaggaaaacggt
ggaaacaattgtgccctttcatttattcttcagattattgttatcgtacaatcgggattagtatagatgatgaactctta
atggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaatt
back to top
>DQ983368.1-SFB13
ttttactcaataa
back to top
>DQ983369.1-SFB.m11092
atgacatttacaatacgtaagaaagaaatcttaatcgacatcctagtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggagttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaacggtttagtttgcatttcggatgagatactgaatttcgatagttctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccggggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagaaattccaccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcatcgagaaaggtcctataatcagcattatgtcattcaattcaggcagt
gaagaattcgaagagttcataacaccagatgccatttgtagttcatggaggtcatgcatcggggtctacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaaggaaaacggt
ggaaacaattgtgccctttcatttattcttcagattattgttatcgtacaatcgggattagtatagatgatgaactctta
atggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaatt
back to top
>DQ983368.1-SFB.m213
ttttactcaataa
back to top