SFB, SFB (gene) Prunus virginiana

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus virginiana
Synonym S-locus F-box 4
S-locus F-box 2
S-locus F-box 1
S-locus F-box 8
S-locus F-box 7
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBJF907567.1-SFBPrunus virginianagene
SFBJF907566.1-SFBPrunus virginianagene
SFBJF907565.1-SFBPrunus virginianagene
SFBJF907564.1-SFBPrunus virginianagene
SFBJF907563.1-SFBPrunus virginianagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBJF907567.1-SFB.m1Prunus virginianamRNA
SFBJF907566.1-SFB.m1Prunus virginianamRNA
SFBJF907565.1-SFB.m1Prunus virginianamRNA
SFBJF907564.1-SFB.m1Prunus virginianamRNA
SFBJF907563.1-SFB.m1Prunus virginianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus virginianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JF907567.1-SFB N/A JF907567.1
gene parsed from NCBI nr database JF907566.1-SFB N/A JF907566.1
gene parsed from NCBI nr database JF907565.1-SFB N/A JF907565.1
gene parsed from NCBI nr database JF907564.1-SFB N/A JF907564.1
gene parsed from NCBI nr database JF907563.1-SFB N/A JF907563.1
mRNA parsed from NCBI nr database JF907567.1-SFB.m1 N/A JF907567.1
mRNA parsed from NCBI nr database JF907566.1-SFB.m1 N/A JF907566.1
mRNA parsed from NCBI nr database JF907565.1-SFB.m1 N/A JF907565.1
mRNA parsed from NCBI nr database JF907564.1-SFB.m1 N/A JF907564.1
mRNA parsed from NCBI nr database JF907563.1-SFB.m1 N/A JF907563.1

Sequence(s):
>JF907567.1-SFB1103
atatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttctgtgtacatgcaagtcatggattgat
ttgattggcagctccagttttgtcagcacacaccttcataggaatgccacaaaacatacccatgtctatctactatgcct
ccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaagaatttcaacggtctcttttttcca
atgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaacattatgtgatatatggctcaagcaat
ggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatatggaacccctcggttaagaaatttag
gactcctccaatgggcaccaacattaacattaaatttagccatgttgctctccaattcgggttccaccctggggttaacg
actataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttgg
aagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagggtacattttttaatggagtagcata
tcatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagtgaagaattcgaagaattcatagcac
cggatgccatttgcagtccatctgagttatgtattgacgtttacaaggaacgagtttgcttgctttttagcttttattct
tgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgatggaaacaattgtgtccctttattta
tcctgctggtagttatggtacaatcgggataactatagataataaactcttaatggtaagaagggatttccttaggggcg
caggagatctgtgtttgtgtaattacgagtccaagcaggtttttgaaacaggaattgagttggccgtcatgaaatatggc
gaaatcgaattattgtttgcaattacttacatagaaagtttggctttacttaataaatattga
back to top
>JF907566.1-SFB1098
gaaatcgtaatcgacatcctcgtaagactacctgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtga
tttgattggcagctcaagttttgttagcacacatcttaataggaatgtcacaaaacgtgcccatgtctatctactttgcc
tccaccatccaaattttgaatgtgtagtggaccctgatgacccatatttagaagaagaagttcaatggtctctttttccc
aacgaaagatttgagcagtgctccaagttaagccatcccttagggagcacagaacattatgggatatatggctcaagcaa
tggattagtttgcatttcggatgagatattgaatttcgatagtcctatacatatatggaacccgtcagttaggaaaatta
ggaccctgccaataagcaccaacatcattaaatttagccatgttgctttccagttcgggttccatcccggggttgatgac
tataaggctgtaaggatgatgcgtacaaacaaaaatgccttggcggttgaggtttatagtcttagaacagactcttggaa
gatgattgaagcaattcctccttggttaaagtgcgcttggcagcattataagggtacatttttcaatggagtaacatacc
atatcattgaaaaaggtcctatattcagcatcatgtccttcgattcaggcaatgaagaatttgaggaattcatagcacca
gatgcaatttgccgtccatctgaggtatgtattgacgtttacaaggaacaaatttgcttgctttttggattttatcgttg
tgaggagatgggcatggataaaattgacttgtgggttctgcgagaaaaacggtggaaacagttgtgtccttttatttatc
catggggttattgttatcgtataaccgggattagtatagataacgaactcttaatgggaagaagagatttcttaaagggc
gtagcagatctctatttgtgtaagtacgaatccaagcaggttcttgaaacaggaattaagttgggcatcatgacatatgg
ggaaatcgaattcttgttttcacctcattacatggaaagtttggttttactcaattaa
back to top
>JF907565.1-SFB1053
gaaatcttaatcgacatcctcgtaagactacctgcaaaatccctcgttcggtttctaagcacttgcaagtcatggagtga
tttgattggcagctcgagttttgttagcacacaacttcataggaatgtcacaaaacatgcccatgtctatctactctgcc
tccaccacccaaattttgaatgtgtggtcgaccctgatgacccacatttagaagaagaatttcaatggtctcttttctcc
aatgaaacatttgagcacggctccaagttaagccatcccatagggagcacaaaacattatgggatatatggttccagcaa
tggtttagtttgcatttcggatgagatattgaatctcgatagtcctatacacatatggaacccatcggttaggaaattta
agaccgttccaataagcaccaacatcatcaaatttggctatgttgctctccaattcgggttccacccaggggttaatgac
tacaaggctgtaaggatgatgcgcaccaacaaagatgccttggcggttgaggtttatagtcttagaacagactcttggaa
gatgattgaagcaattcctccttggttaaagtgcgcttggcagcatcataaaggtacattttataatggagtaacatacc
tcatcattgagaaaggtcctctattcagcattatgtccttcgattctggcagtgaagaattcgaagaattcatggcacca
gatgccatctgcaattcatgggccttgtgtatcgacgtttacagggaacgaatttgcttgctttttagcttttattcttg
tgaggaggagggcatgcgaaaaagtgacttatgggttctgcaagaaaaacggtggaaacaattgtatccttgtatttatc
cttttcattattgtggtacaatcgggattaccatagataatgaactcttaatgcaaagaaaagatttcactaagggcgga
gcagaactatatttgtgtaattacgaatccaagcaagttcttgaaacaggaattaagttggccgtcaagaaatatggcga
aatcgaattcttg
back to top
>JF907564.1-SFB535
tcctccttggttaaaatgcacttggcagcatcataagggtacattttttaatggtgttgcataccacattattattaaga
aaggtcctatattcagcattatgtcattcgattcgggcagtgaagacttcgaagaattcatagcaccagatgccatttgc
ggttcatgggggttatgtattgacatttacaaggaacaaatttgcttgcttcttaagttttattcttgtgaggaggaggg
cctgcacaaaattgacttatgggttctgcaagaaaagcggtggaaacaattgtgtccttttctttatcctttggattatt
attattattgtacaatcgggattagtacagataatagactcttaatggtaagaatagatgacatgggaggcataacagat
ctgcatttgtgtggttacgaattcaagcaaattcttgagacaggaattaagttggccatcatgaaatatggcgaaattga
attcttcctttcaacttcttacacagaaagtttggttttactcaataattattaa
back to top
>JF907563.1-SFB526
tcctccttggttaaaatgcacttggcagcatcatacgggtatatttttaaatggagtggcatacaccatcattgagaaag
gtcgtatatttagcattatgtcatttgatacaggcagtgaagaattcggagaattcataacaccagatgccatttctaat
ccatctgacttatgtattggcgtttacaaggaacaaatttgcttgcttcttgacttttatccttgtgaggtggagggcat
ggacaaaattgacttacggattctgcaagagaaacggtggaaacaatcgcgtcctttttttatacccttgagttattatt
gcacaatcgggattagtacagataataaactgttaatgctaagaatagatgatattgggggcatagcagatctgcatttg
tgtgattacgaatccaaggaagttcttgaaacaggaattaagttggccaccatgaaatatggcgaaattgaattattgtt
ttcattttcttacatagagagtttggttttactcgatgattattaa
back to top
>JF907567.1-SFB.m11103
atatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttctgtgtacatgcaagtcatggattgat
ttgattggcagctccagttttgtcagcacacaccttcataggaatgccacaaaacatacccatgtctatctactatgcct
ccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaagaatttcaacggtctcttttttcca
atgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaacattatgtgatatatggctcaagcaat
ggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatatggaacccctcggttaagaaatttag
gactcctccaatgggcaccaacattaacattaaatttagccatgttgctctccaattcgggttccaccctggggttaacg
actataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttgg
aagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagggtacattttttaatggagtagcata
tcatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagtgaagaattcgaagaattcatagcac
cggatgccatttgcagtccatctgagttatgtattgacgtttacaaggaacgagtttgcttgctttttagcttttattct
tgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgatggaaacaattgtgtccctttattta
tcctgctggtagttatggtacaatcgggataactatagataataaactcttaatggtaagaagggatttccttaggggcg
caggagatctgtgtttgtgtaattacgagtccaagcaggtttttgaaacaggaattgagttggccgtcatgaaatatggc
gaaatcgaattattgtttgcaattacttacatagaaagtttggctttacttaataaatattga
back to top
>JF907566.1-SFB.m11098
gaaatcgtaatcgacatcctcgtaagactacctgcaaaatccctcgttcggtttctgtgtacatgcaagtcatggagtga
tttgattggcagctcaagttttgttagcacacatcttaataggaatgtcacaaaacgtgcccatgtctatctactttgcc
tccaccatccaaattttgaatgtgtagtggaccctgatgacccatatttagaagaagaagttcaatggtctctttttccc
aacgaaagatttgagcagtgctccaagttaagccatcccttagggagcacagaacattatgggatatatggctcaagcaa
tggattagtttgcatttcggatgagatattgaatttcgatagtcctatacatatatggaacccgtcagttaggaaaatta
ggaccctgccaataagcaccaacatcattaaatttagccatgttgctttccagttcgggttccatcccggggttgatgac
tataaggctgtaaggatgatgcgtacaaacaaaaatgccttggcggttgaggtttatagtcttagaacagactcttggaa
gatgattgaagcaattcctccttggttaaagtgcgcttggcagcattataagggtacatttttcaatggagtaacatacc
atatcattgaaaaaggtcctatattcagcatcatgtccttcgattcaggcaatgaagaatttgaggaattcatagcacca
gatgcaatttgccgtccatctgaggtatgtattgacgtttacaaggaacaaatttgcttgctttttggattttatcgttg
tgaggagatgggcatggataaaattgacttgtgggttctgcgagaaaaacggtggaaacagttgtgtccttttatttatc
catggggttattgttatcgtataaccgggattagtatagataacgaactcttaatgggaagaagagatttcttaaagggc
gtagcagatctctatttgtgtaagtacgaatccaagcaggttcttgaaacaggaattaagttgggcatcatgacatatgg
ggaaatcgaattcttgttttcacctcattacatggaaagtttggttttactcaattaa
back to top
>JF907565.1-SFB.m11053
gaaatcttaatcgacatcctcgtaagactacctgcaaaatccctcgttcggtttctaagcacttgcaagtcatggagtga
tttgattggcagctcgagttttgttagcacacaacttcataggaatgtcacaaaacatgcccatgtctatctactctgcc
tccaccacccaaattttgaatgtgtggtcgaccctgatgacccacatttagaagaagaatttcaatggtctcttttctcc
aatgaaacatttgagcacggctccaagttaagccatcccatagggagcacaaaacattatgggatatatggttccagcaa
tggtttagtttgcatttcggatgagatattgaatctcgatagtcctatacacatatggaacccatcggttaggaaattta
agaccgttccaataagcaccaacatcatcaaatttggctatgttgctctccaattcgggttccacccaggggttaatgac
tacaaggctgtaaggatgatgcgcaccaacaaagatgccttggcggttgaggtttatagtcttagaacagactcttggaa
gatgattgaagcaattcctccttggttaaagtgcgcttggcagcatcataaaggtacattttataatggagtaacatacc
tcatcattgagaaaggtcctctattcagcattatgtccttcgattctggcagtgaagaattcgaagaattcatggcacca
gatgccatctgcaattcatgggccttgtgtatcgacgtttacagggaacgaatttgcttgctttttagcttttattcttg
tgaggaggagggcatgcgaaaaagtgacttatgggttctgcaagaaaaacggtggaaacaattgtatccttgtatttatc
cttttcattattgtggtacaatcgggattaccatagataatgaactcttaatgcaaagaaaagatttcactaagggcgga
gcagaactatatttgtgtaattacgaatccaagcaagttcttgaaacaggaattaagttggccgtcaagaaatatggcga
aatcgaattcttg
back to top
>JF907564.1-SFB.m1535
tcctccttggttaaaatgcacttggcagcatcataagggtacattttttaatggtgttgcataccacattattattaaga
aaggtcctatattcagcattatgtcattcgattcgggcagtgaagacttcgaagaattcatagcaccagatgccatttgc
ggttcatgggggttatgtattgacatttacaaggaacaaatttgcttgcttcttaagttttattcttgtgaggaggaggg
cctgcacaaaattgacttatgggttctgcaagaaaagcggtggaaacaattgtgtccttttctttatcctttggattatt
attattattgtacaatcgggattagtacagataatagactcttaatggtaagaatagatgacatgggaggcataacagat
ctgcatttgtgtggttacgaattcaagcaaattcttgagacaggaattaagttggccatcatgaaatatggcgaaattga
attcttcctttcaacttcttacacagaaagtttggttttactcaataattattaa
back to top
>JF907563.1-SFB.m1526
tcctccttggttaaaatgcacttggcagcatcatacgggtatatttttaaatggagtggcatacaccatcattgagaaag
gtcgtatatttagcattatgtcatttgatacaggcagtgaagaattcggagaattcataacaccagatgccatttctaat
ccatctgacttatgtattggcgtttacaaggaacaaatttgcttgcttcttgacttttatccttgtgaggtggagggcat
ggacaaaattgacttacggattctgcaagagaaacggtggaaacaatcgcgtcctttttttatacccttgagttattatt
gcacaatcgggattagtacagataataaactgttaatgctaagaatagatgatattgggggcatagcagatctgcatttg
tgtgattacgaatccaaggaagttcttgaaacaggaattaagttggccaccatgaaatatggcgaaattgaattattgtt
ttcattttcttacatagagagtttggttttactcgatgattattaa
back to top