SFB, SFB (gene) Prunus webbii

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Prunus webbii
Synonym S locus-linked F-box protein
S locus F-box protein
SLF1
Description NA
Comment PwSLF
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAB731120.1-SFBPrunus webbiigene
SFBAB731119.1-SFBPrunus webbiigene
SFBAB731118.1-SFBPrunus webbiigene
SFBDQ993669.1-SFBPrunus webbiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBAB731120.1-SFB.m1Prunus webbiimRNA
SFBAB731119.1-SFB.m1Prunus webbiimRNA
SFBAB731118.1-SFB.m1Prunus webbiimRNA
SFBDQ993669.1-SFB.m1Prunus webbiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus webbiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB731120.1-SFB N/A AB731120.1
gene parsed from NCBI nr database AB731119.1-SFB N/A AB731119.1
gene parsed from NCBI nr database AB731118.1-SFB N/A AB731118.1
gene parsed from NCBI nr database DQ993669.1-SFB N/A DQ993669.1
mRNA parsed from NCBI nr database AB731120.1-SFB.m1 N/A AB731120.1
mRNA parsed from NCBI nr database AB731119.1-SFB.m1 N/A AB731119.1
mRNA parsed from NCBI nr database AB731118.1-SFB.m1 N/A AB731118.1
mRNA parsed from NCBI nr database DQ993669.1-SFB.m1 N/A DQ993669.1

Sequence(s):
>AB731120.1-SFB1002
cctagtaagactacctgcaaaatcccttgttcggtttctttgtacatgcaagtcttggagtgatttgattggcagctcga
gttttgttagcatacaccttaacaggaacgtcaaaaagcacgcccatctttatctactctgcctccaccacccaaatttt
gaacgtctggccgaccctgatgatccatatgttaagcaaggatttcagtggtctcttttttctaatgaaacatttgagga
gtgctccaagttaagccatcccttagggagcacagaaccttatgtgatttatggctcaagcaatggtttagtttgcattt
ccgatgagatactgaatttcgatagtcctatacacatatggaacccatcggttagtaaacttagaaccacgccaatcagc
accaatattagcattaaatttagccatgttgctctccaattcgggttccaccccgggtttaatgactacaaggctataag
gatgttgcgtaccaacaaaaaggcattagcggttgaggtttatagtctcagagcagactcttggaagatgattgaagcaa
ttcctccttggttaaaatgcacttggcagcatcatgacggcacattctttaatggagtagcataccacatcattgaaaaa
ggtcctatattaagtattatatccttcgattcaggcagtgaagaattcgaagaattcatagcaccggatgccatttgcag
ttcgtggcgattatgcatccgcgtttacaaggaacaaatttgcttgttttttggattttatggttgtgaggaggagggca
tggaaaaaattgacttatggggtctgcaagaaaaacggtggaaacaattgtgtccttttatttatgatcctttagattat
tgttatcgtataattgggattagtatagataatgaactcttaatgggaagagaaggttttgctaagggcgtagcagatct
ggatttgtgcaattacgaatccaagctagtacgtgaaactgg
back to top
>AB731119.1-SFB1038
cctagcaagactacctgcaaaatccctcgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctcga
gttttgtcagcacacaccttcataggaatgtcacaacgcatgaccatgtctatctactttgcctccaccacccaaatttt
gaacgtttggtcgaccctgataacccatatgttaaaaaggaatttcaatggtctcttttttccaatgagacatttaagca
gtgctacaaattaaaccatcccttaggcagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcattt
cggatgagatattgaatttcgatagtcctatacacgtatggaatccatcggttaggaaatttaggacccctccaatgagc
actagcattaacattaaatttaattatattgctctccagtttgggttccaccccagggttaatgactacaaggcagtaag
gatgatgcgtaccaacaaagatgccttggtcgttgaggtttatagtcttagaacagactcttggaagatgattgaagcaa
ttcctccttggttaaaatgcacttggcagcatcacaagggtatgttttttaatggcatatcattccacatcattgagaaa
tgtcctatattcagcattatgtcattcgattctggcagtgaagaattcgaagagttcatagcaccagatgtcatttgcag
ttcatgggggttatgtattgacctttacaaggaacaaatttgtttgctttctagcttttattcttgcgaggagaagggta
tgcgaaaaattgacttctgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttatccttctcattattat
ggtacactcggtattagtatagataacgaactcttaatggaaaagagagatttctctaggggcataggagatctgcattt
gtgtaattacgaatccaagcaagttcttgaaacaggaatcgacttggccaccatcaaatatggtgaaatcgaattctt
back to top
>AB731118.1-SFB1041
cctactaagactacctgcaaagccactcgttcggtttctgtgtatatgcaagtcatggagtgatttaattggaagctcga
gttttgttagcgcgcacatcggtagcaatatcactaaacatgcccatgtctgtcttctttgcctccaccccaaaaatttt
gaatgccaggacaacccggatgacccttacgctaaacaagactttcaatggtctcttttttccaatgaaacatttgagca
gtgctccaagttaaggcatccattagggagcgcagaacattactggatatatggttcaagcaatggtttagtttgcattt
cggatgagatattgaatttcgatactcctatacacatactgaacccagcggttacgaactttaggacccttccaattagt
acaaacattaacattaaattttcgtatattgctctccaatttgggtttcacccagaagttagtgactacaaggctgtaag
gatgatgcgtaccaacaaaaatgccttagcagttgaggtttatagtcttagaacagactcttggaagatgattgaagcaa
tacctccttggttaaaatgcaagtggcagcatcatcagggtacaatttttaagggagttgcataccacatcattgagaaa
ggtcctatattcagcattatgtccttcgatttaggcagtgaagaatttgaagaattcatagcaccagatgcaatttgcag
ttcttggaggttattcatcgacgtttacaaggaacaaatttgcttgctttttgggttttatggttgtgaggaggagggca
tggaaaaaactgacttatgggttctgcaagaaaaacggtggaaacacctgtgtccttttatttatccttttgatcattat
tatagtataatggggattagtataaataatgaactcttaatggcaagaagagatttcggtaagggcgtagcagatctgta
tttgtgtaattaccaatccaagcaagttcttgaaacaggaattaagttggccgtcattacatatggcgaaatccaattct
t
back to top
>DQ993669.1-SFB1104
atcaacaatcccacgttcgtggaaaatcatctctctaattcgatgcagagcaaactgtctacctgcgtccttttcagtcg
ttttgaccagagcgacgctaacagtgatgagaaggaacttgcattctccttcctttacctccgaaatgattatgatgatg
atgagcataacgtcaattttgttgttgaggacatcaagtttccactttcttcgggacgatttattgggctcgaggatgta
gaatctccaagtattttaggccattgtaatgggatagtttgtctaagtccttgtagtgacaaccttgttttatgcaatcc
agcaatcaaggaaatcaaacttctacccaaatcaggtcttccagattggtggggatgtgctgtagggtttggatatgatc
ccaaatctaaagattacaaagttagtagaattgcatcttatcaggcggacatttatggtgatggtcttatttatcctcct
agagttgaaatatacaccctcagtactgattcttggcgagagatcaggaataattctttagaaacagatactacttgctt
ttttcctgattatttccagatgtacttccaaggaatttgttattgggtggggtatgaacaaccaaaacaatctgtggaat
acgaggacgaggaacagaagccaatggtccttttcttcgacacgggtgatgaaatatttcataatctattatttcctgat
agtttttatatgtatgaggaaggatcatcttatgcttatgaaatgtcttatcttatgtattgtgatctgcgcattatact
gtggaatggatctattgctctttttgggtttaatcgttttagtgtatttcctgactcctatggagtttgggtattggatg
actttgacggtgctaagggttcgtggacaaaacacttaacttttgagccattgatgggcagtaagaaggtattggaattt
tggaggagtgacgagattcttatggttaccgaagatggagatatagtatcttacaaccttgcaactgagaagcttaagaa
tcttcccatgaatagcccatctgatttcgaaactattgtgtatgtgaatagcttagttccgata
back to top
>AB731120.1-SFB.m11002
cctagtaagactacctgcaaaatcccttgttcggtttctttgtacatgcaagtcttggagtgatttgattggcagctcga
gttttgttagcatacaccttaacaggaacgtcaaaaagcacgcccatctttatctactctgcctccaccacccaaatttt
gaacgtctggccgaccctgatgatccatatgttaagcaaggatttcagtggtctcttttttctaatgaaacatttgagga
gtgctccaagttaagccatcccttagggagcacagaaccttatgtgatttatggctcaagcaatggtttagtttgcattt
ccgatgagatactgaatttcgatagtcctatacacatatggaacccatcggttagtaaacttagaaccacgccaatcagc
accaatattagcattaaatttagccatgttgctctccaattcgggttccaccccgggtttaatgactacaaggctataag
gatgttgcgtaccaacaaaaaggcattagcggttgaggtttatagtctcagagcagactcttggaagatgattgaagcaa
ttcctccttggttaaaatgcacttggcagcatcatgacggcacattctttaatggagtagcataccacatcattgaaaaa
ggtcctatattaagtattatatccttcgattcaggcagtgaagaattcgaagaattcatagcaccggatgccatttgcag
ttcgtggcgattatgcatccgcgtttacaaggaacaaatttgcttgttttttggattttatggttgtgaggaggagggca
tggaaaaaattgacttatggggtctgcaagaaaaacggtggaaacaattgtgtccttttatttatgatcctttagattat
tgttatcgtataattgggattagtatagataatgaactcttaatgggaagagaaggttttgctaagggcgtagcagatct
ggatttgtgcaattacgaatccaagctagtacgtgaaactgg
back to top
>AB731119.1-SFB.m11038
cctagcaagactacctgcaaaatccctcgttcggtttctttgtacatgcaagtcatggagtgatttgattggcagctcga
gttttgtcagcacacaccttcataggaatgtcacaacgcatgaccatgtctatctactttgcctccaccacccaaatttt
gaacgtttggtcgaccctgataacccatatgttaaaaaggaatttcaatggtctcttttttccaatgagacatttaagca
gtgctacaaattaaaccatcccttaggcagcacagaacattatgtgatatatggttcaagcaatggtttagtttgcattt
cggatgagatattgaatttcgatagtcctatacacgtatggaatccatcggttaggaaatttaggacccctccaatgagc
actagcattaacattaaatttaattatattgctctccagtttgggttccaccccagggttaatgactacaaggcagtaag
gatgatgcgtaccaacaaagatgccttggtcgttgaggtttatagtcttagaacagactcttggaagatgattgaagcaa
ttcctccttggttaaaatgcacttggcagcatcacaagggtatgttttttaatggcatatcattccacatcattgagaaa
tgtcctatattcagcattatgtcattcgattctggcagtgaagaattcgaagagttcatagcaccagatgtcatttgcag
ttcatgggggttatgtattgacctttacaaggaacaaatttgtttgctttctagcttttattcttgcgaggagaagggta
tgcgaaaaattgacttctgggttctgcaagaaaaacggtggaaacaattgtgtccttttatttatccttctcattattat
ggtacactcggtattagtatagataacgaactcttaatggaaaagagagatttctctaggggcataggagatctgcattt
gtgtaattacgaatccaagcaagttcttgaaacaggaatcgacttggccaccatcaaatatggtgaaatcgaattctt
back to top
>AB731118.1-SFB.m11041
cctactaagactacctgcaaagccactcgttcggtttctgtgtatatgcaagtcatggagtgatttaattggaagctcga
gttttgttagcgcgcacatcggtagcaatatcactaaacatgcccatgtctgtcttctttgcctccaccccaaaaatttt
gaatgccaggacaacccggatgacccttacgctaaacaagactttcaatggtctcttttttccaatgaaacatttgagca
gtgctccaagttaaggcatccattagggagcgcagaacattactggatatatggttcaagcaatggtttagtttgcattt
cggatgagatattgaatttcgatactcctatacacatactgaacccagcggttacgaactttaggacccttccaattagt
acaaacattaacattaaattttcgtatattgctctccaatttgggtttcacccagaagttagtgactacaaggctgtaag
gatgatgcgtaccaacaaaaatgccttagcagttgaggtttatagtcttagaacagactcttggaagatgattgaagcaa
tacctccttggttaaaatgcaagtggcagcatcatcagggtacaatttttaagggagttgcataccacatcattgagaaa
ggtcctatattcagcattatgtccttcgatttaggcagtgaagaatttgaagaattcatagcaccagatgcaatttgcag
ttcttggaggttattcatcgacgtttacaaggaacaaatttgcttgctttttgggttttatggttgtgaggaggagggca
tggaaaaaactgacttatgggttctgcaagaaaaacggtggaaacacctgtgtccttttatttatccttttgatcattat
tatagtataatggggattagtataaataatgaactcttaatggcaagaagagatttcggtaagggcgtagcagatctgta
tttgtgtaattaccaatccaagcaagttcttgaaacaggaattaagttggccgtcattacatatggcgaaatccaattct
t
back to top
>DQ993669.1-SFB.m11104
atcaacaatcccacgttcgtggaaaatcatctctctaattcgatgcagagcaaactgtctacctgcgtccttttcagtcg
ttttgaccagagcgacgctaacagtgatgagaaggaacttgcattctccttcctttacctccgaaatgattatgatgatg
atgagcataacgtcaattttgttgttgaggacatcaagtttccactttcttcgggacgatttattgggctcgaggatgta
gaatctccaagtattttaggccattgtaatgggatagtttgtctaagtccttgtagtgacaaccttgttttatgcaatcc
agcaatcaaggaaatcaaacttctacccaaatcaggtcttccagattggtggggatgtgctgtagggtttggatatgatc
ccaaatctaaagattacaaagttagtagaattgcatcttatcaggcggacatttatggtgatggtcttatttatcctcct
agagttgaaatatacaccctcagtactgattcttggcgagagatcaggaataattctttagaaacagatactacttgctt
ttttcctgattatttccagatgtacttccaaggaatttgttattgggtggggtatgaacaaccaaaacaatctgtggaat
acgaggacgaggaacagaagccaatggtccttttcttcgacacgggtgatgaaatatttcataatctattatttcctgat
agtttttatatgtatgaggaaggatcatcttatgcttatgaaatgtcttatcttatgtattgtgatctgcgcattatact
gtggaatggatctattgctctttttgggtttaatcgttttagtgtatttcctgactcctatggagtttgggtattggatg
actttgacggtgctaagggttcgtggacaaaacacttaacttttgagccattgatgggcagtaagaaggtattggaattt
tggaggagtgacgagattcttatggttaccgaagatggagatatagtatcttacaaccttgcaactgagaagcttaagaa
tcttcccatgaatagcccatctgatttcgaaactattgtgtatgtgaatagcttagttccgata
back to top