SFB, SFB (gene) Pyrus sinkiangensis

Gene Overview
Name SFB
Gene Symbol SFB
Type gene
Organism Pyrus sinkiangensis
Synonym S-haplotype-specific F-box protein
Description NA
Comment may be involved in control of plant self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBGQ456944.1-SFB.m1Pyrus sinkiangensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus sinkiangensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GQ456944.1-SFB.m1 N/A GQ456944.1

Sequence(s):
>GQ456944.1-SFB.m11101
atggcattcatactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcggtttgt
ttgtacatgcaagtcatggagtgatttgattggtagctccagttttgttagcatacacgttaacaggaatgtcacaaaac
atgcccatgtctatttattctgcctccaccacccaaattttgaacgtcagaatgacaatgatgacccatatgatatagaa
gaacttcaatggtcgcttttttccaatgaaacgtttcagcagttctccaagttgagccatcccttagaaagcacagagca
gtataggatatatggtgcaagcaatggtttagtttgcatttcagatgagatattgaatttcgatagtcctatacacatat
ggaacccgtctgttaggaaatttaggacccctccaatgagcaccaacattaacatgaaattttcccatgttgctctccaa
ctcggtttccaccccggggttaatgactacaaggctgtaaggatcatgcgtaccaacaaaggtgccttggcagttgaggt
ttacagtcttaaaacatactgttggaagatgattgaagcaattcctccttggttaaaatgcacttggaagcatcataagg
gtacattttttaatggagtagcataccacatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcaat
gaagaattcgaagaattcatagcaccagatgacatttgcagttcatgggggttatgcatcgacatttacaaggaacgaat
ttgcttgctttttgacttttatccttgtgaggaggagtgcatggaaaaacggtggaaacaattgtgtccttttatttatt
cttcggattattgttttcgtacaatcgggattagtatagataatgaactcttattggcaagaagaggtttcgatcagggc
atagcagatctgtgtttgtgtaattacgaatccaagcaagctcttgaaacagatataaagttggccgtcatgagatatgg
tgaaatcgaatccttgtttgcaattaattacgtagaaagtttggttttactcaataattga
back to top