SLF6-S21, SLF6-S21 (gene) Pyrus x bretschneideri

Gene Overview
Name SLF6-S21
Gene Symbol SLF6-S21
Type gene
Organism Pyrus x bretschneideri
Synonym S-Locus F-box 6-S21
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SLF6-S21HE802070.2-SLF6-S21Pyrus x bretschneiderigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SLF6-S21HE802070.2-SLF6-S21.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HE802070.2-SLF6-S21 scaffold00905:17939..19118
HE802070.2
mRNA parsed from NCBI nr database HE802070.2-SLF6-S21.m1 scaffold00905:17939..19118
HE802070.2

Sequence(s):
>HE802070.2-SLF6-S211179
atgtcccaggtgcatgaaagtgaaactcctcaagataaggtggtcgaaatcttgtccaggttgccgcccaagtccctgat
gagattcaaatgcgtacacaaatcatggtgcactatcatcaatagtccaagttttgtggccaaacacgtcagcaataccg
tggacaacaaattctcatccttcacttgcatccttttcaaccgatctcaggttcatgttttcgcggacaggagttggaaa
agagatgttttctggtctacgattaatctttccattgaaagtgatgagcacaaccttcattatgatgtcaaggacctaaa
tataccctttcctatggaagttcaagacaatgtacagctttacggttattgcaatgggattgtctgtgtaatagtagggg
aaaatgttcttctatgcaatcctgcaacaagagaattcaagcaacttcccgattcatccctttttctaccccttccgacg
ggaaaattcggattggaaacgctctttaaaggattgggatttggctatgattgcaaaactaaagaatataaggttgtgcg
aattatagaaaattgtgattgtgagtattcagaaggtaaagaatcatattatgagcgtattcttcttccctacacggctg
aggtatacaccacgactgctaactcttggaaagagatcaagattgatacatcaagtgatactgatccgtattgcattccc
tattcttgttcagtgtacttgaagggattttgttattggtttgcaaacgataacggggaatacatattttcatttgattt
aggtgatgagatatttcgtagaatagaattgccttttaggagagaatccgattttaatttttatggtctttttctgtata
atgaatccgtcgcttcttattgctctcgttacgaagaggattgtaaattgcttgaaatatgggtaatggacgaccatgat
ggagtgaagagttcatggacaaaactcctaaccgttggaccctttaaagacattgagtctccttcgacattttggaaatg
tgacgaggttcttatcctttcctcatatggaaaagccacctcttataattctggtaccgaaaatctcaagtatcttcata
ttcctcctattatcaattggatgatagattatgtggaaactattgttccagtcaagtga
back to top
>HE802070.2-SLF6-S21.m11179
atgtcccaggtgcatgaaagtgaaactcctcaagataaggtggtcgaaatcttgtccaggttgccgcccaagtccctgat
gagattcaaatgcgtacacaaatcatggtgcactatcatcaatagtccaagttttgtggccaaacacgtcagcaataccg
tggacaacaaattctcatccttcacttgcatccttttcaaccgatctcaggttcatgttttcgcggacaggagttggaaa
agagatgttttctggtctacgattaatctttccattgaaagtgatgagcacaaccttcattatgatgtcaaggacctaaa
tataccctttcctatggaagttcaagacaatgtacagctttacggttattgcaatgggattgtctgtgtaatagtagggg
aaaatgttcttctatgcaatcctgcaacaagagaattcaagcaacttcccgattcatccctttttctaccccttccgacg
ggaaaattcggattggaaacgctctttaaaggattgggatttggctatgattgcaaaactaaagaatataaggttgtgcg
aattatagaaaattgtgattgtgagtattcagaaggtaaagaatcatattatgagcgtattcttcttccctacacggctg
aggtatacaccacgactgctaactcttggaaagagatcaagattgatacatcaagtgatactgatccgtattgcattccc
tattcttgttcagtgtacttgaagggattttgttattggtttgcaaacgataacggggaatacatattttcatttgattt
aggtgatgagatatttcgtagaatagaattgccttttaggagagaatccgattttaatttttatggtctttttctgtata
atgaatccgtcgcttcttattgctctcgttacgaagaggattgtaaattgcttgaaatatgggtaatggacgaccatgat
ggagtgaagagttcatggacaaaactcctaaccgttggaccctttaaagacattgagtctccttcgacattttggaaatg
tgacgaggttcttatcctttcctcatatggaaaagccacctcttataattctggtaccgaaaatctcaagtatcttcata
ttcctcctattatcaattggatgatagattatgtggaaactattgttccagtcaagtga
back to top