SLFBL12, SLFBL12 (gene) Malus x domestica

Gene Overview
Name SLFBL12
Gene Symbol SLFBL12
Type gene
Organism Malus x domestica
Synonym S-locus F-box brothers-like protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SLFBL12GU345808.1-SLFBL12.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU345808.1-SLFBL12.m1 N/A GU345808.1

Sequence(s):
>GU345808.1-SLFBL12.m11179
atgtcccaggtgcgtaaaattgaaactcttgaagataagctggtcgaaattctatctaggttaccgcccaagtccttgat
gagattcaaatgcatacacaggtcttggtgcgctatcataagtagtccaagttttgtggccaaacacctcagcaattcca
tggacaacaaactctcatcctccacttgtatccttctcaaccgttgtcaggttcacgttttccaggataggagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgatgagagaaatcttcattatgatgttgaggacctaaa
tataccgtttccaatggaagatcaagacaatgtagagcttcacggttattgcaatgggattgtctctgtaaaagtaggga
aaaatgttcttttatgcaatcctgcaacaggagaattcaggcaacttcctaattcatcccttcttctaccccttcccaag
ggaagattcggattggaaaccatctttaaaggattgggatttggctatgattgcaaaactaaagcgtacaaggttgtgca
aattatagaaaattgtgattgtgagtattcagaaggtgaagaatcatattatgagcgtattcttcttccttacacggctg
aggtatacaccatgactgctaactcttggagagagatcaagattgatacatcaagtgatactgatccgtattgcattccc
tattctggttcagtgtacttgaagggattttgttattggtttgcaaacgataatggggaatacgtattttcatttgattt
gtgtgatgagatatttcatagaatagaattgccttctaggggacaattcgattttaagttttatggtatttttctgtata
atgaatccatcgcttcttattgctctcgttacgaagaggattgtaaattatttgaaatatgggtaatggatgattatgac
ggagttaagagttcatggactaaactgctaactgttggaccctttaaagacattgattatccattgacatttgggaaatg
tgatgaggttcttatgcttggctcgtatggaagagcggcctcttgtaattctagtaccggaaatctcaagtattttcata
ttcctcccattatcaattggatgatcgattatgtgaaaagtattgttccaatcaagtga
back to top