SLFBL8, SLFBL8 (gene) Malus x domestica

Gene Overview
Name SLFBL8
Gene Symbol SLFBL8
Type gene
Organism Malus x domestica
Synonym S-locus F-box brothers
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SLFBL8GU345817.1-SLFBL8.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU345817.1-SLFBL8.m1 N/A GU345817.1

Sequence(s):
>GU345817.1-SLFBL8.m11185
atgtcccaggtgcgtaaaactgaaactcctgaagatagggtggtcgcaatcatgtccaagttgccgcccaagtctctgat
gcgattcaaatgcatacgcaagtcttggtgcactctcatccatagtccaagttttgtggccaaacacctcagcaattctg
tggacaacaaattctcatcctacaattgtatcctcctgaaccgttctcaggttcacgttttcccggacaagagttggaaa
catgaagttttatggtccatgattagtctttttaatgaaagacttgcacgcagcctttattatgatgttaaggacctaaa
tataccgtttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtctgtgtaatatcaggga
aaaatattcttttatgcaatcctgcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctc
ggcggaaaattcgaattggagaccgatttgggtggattgggatttggctacgattgcagagctaaagattacaaggttgt
gcgaattatagaaaattgtgagtattcagatgatgagcgaacatattatcatcgtattcctctgcctcacacggctgagg
tatacaccatggctactaactcttggaaagagatcaagattcatatatcaagtaaaacttatccctgttcttgttcggtg
tacttgaagggattttgttattggtttacaagggatggtgaggaattcatactttcatttgatttaggcgatgagagatt
tcatagaatacaattgccttctaggagagaatccggttttgagtttttttatatttttctgtgtaatgaatccattgctt
ctttttgctctctttgtgatcgaagtgaagattctaaatcatgtgaaatatgggtaatggacgactatgatggagtcaag
agttcatggacaaaactcctagttgctggaccctttaaaggcattgagaagccattgacactttggaaatgtgacgagct
tcttatgattgacactgatggaagagtcatctcttataattctggtattggatatctcacctatcttcatattcctccga
ttatcaatagggttatagattctcaagctcttatttatgtagaaagtattgttccagtcaagtga
back to top