SOD2, SOD2 (gene) Malus baccata var. xiaojinensis

Gene Overview
Name SOD2
Gene Symbol SOD2
Type gene
Organism Malus baccata var. xiaojinensis
Synonym Sod2
Description NA
Comment MxSod2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
superoxide dismutaseSODMalus baccata var. xiaojinensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SOD2DQ431473.1-SOD2.m1Malus baccata var. xiaojinensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ431473.1-SOD2.m1 Chr12:30654245..30656005
chr12:29532635..29534395
chr8:13783176..13784936
chr12:34087163..34088923
DQ431473.1

Sequence(s):
>DQ431473.1-SOD2.m1459
atggtgaagggtgttgctgttctcggctccagtgagggtgttaaaggaaccatcaactttgtccaggagggagatggtcc
aactactgtgactggatgtatctctggcctcaagcctggacttcatggtttccacgtccatgctttcggagacacaacaa
acggttgcttgtcaactgggccacacttcaatcctaatggaaaagagcatggtgcccctgaagatgaggatcgtcatgct
ggcgaccttggaaatgtcactgttggggatgatggaactgcaaccttcacacttattgacaagcagatacctctaaccgg
accccactctgtcattggtagggcagttgttgtccatggcgacccagatgacctgggcaagggtggacatgagcttagca
aatccactggaaatgctggtggcagggtagcttgtggtattatcggtctgcaaggatga
back to top