SOD, SOD (gene) Fragaria x ananassa

Gene Overview
Name SOD
Gene Symbol SOD
Type gene
Organism Fragaria x ananassa
Synonym Mn-superoxide dismutase
Cu/Zn-superoxide dismutase
MnSOD
Cu/ZnSOD
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SODKC433893.1-SOD.m1Fragaria x ananassamRNA
SODKC433884.1-SOD.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
superoxide dismutaseSODFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KC433893.1-SOD.m1 LG7:18097220..18099417
KC433893.1
mRNA parsed from NCBI nr database KC433884.1-SOD.m1 LG1:19229967..19231298
KC433884.1

Sequence(s):
>KC433893.1-SOD.m1650
cggattaggtttccagaactttctcggcgcgcgtggactgcagacgttctctctccccgacctcccctacgactacggcg
ctctcgagccggcgattagcgccgagatcatgcaaatccaccaccagaagcaccaccagacttacatcaccaactacaac
aaggctctcgagcagctggacgccgcgatttccaagggcgacgcctccgccgtcgtgaagctgcagagcgccatcaaatt
caacggcggaggtcatgtcaaccactcaattttctggaataacctggctcctgttaatcaaggaggtggtgaggcccctc
atgcttccctgggctgggctattgaccaaagctttggttcttttgatgcgttaatcgcaaaggtcaatgcagaaggtgct
gggttgcagggatctggatgggtgtggctggctctagacaaagaactgaagaagcttgtggttgaaactacggcaaatca
ggacccattggttaccaaaggagcaagtttagtgcctttgcttggcattgatgtttgggagcacgcatactacttacagt
acaagaatgtgagaccagattatctaaagaatatatggaaggtcatcaattggaagtatgccagtaaagtgtacgagaaa
gaaagtgctt
back to top
>KC433884.1-SOD.m1430
atggcaaagggcgttgctgtgctttgctccagtgagggtgttgctggaactatcctcttcacccaagagggagatggccc
aactactgtgaccggaaacattactggcctcaagcctgggcttcatggtttccatgttcatgctcttggggacaccacaa
atggttgcatgtcaactggaccacacttcaatcctgctggcaaagagcatggtgctcctgaagatgagaatcgtcatgct
ggtgatcttggaaatatcactgttggggatgatggaaaggcttgcttcacaattgttgacaagcagattcctctcactgg
accacactctatcattggtagggctgctgttgtccatggagaccctgatgatcttggcaagggtggacatgagcttagca
aatccactggaaatgctggtggcaggatag
back to top