SOD, SOD (gene) Malus pumila

Gene Overview
Name SOD
Gene Symbol SOD
Type gene
Organism Malus pumila
Synonym superoxidase dismutase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
superoxide dismutaseSODMalus pumilagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SODGU321225.1-SOD.m1Malus pumilamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU321225.1-SOD.m1 N/A GU321225.1

Sequence(s):
>GU321225.1-SOD.m1452
aagaaagccgttgctgtccttaaaggtacttccggtgttgaaggcgtcgtcactctatctcaagatgatgatggtcctac
aacagtgaatgttcgtattactggccttactccagggcttcatgggtttcatttacatgaatatggtgataccacaaatg
ggtgtatctcaacaggaccacatttcaaccctaacaagttgacacatggtgctcctggagatgaaatccgtcatgcgggt
gacctgggaaacatagtggccaatgccgatggcgtggcagaagcgacaatcgtggacaatcagataccattgaccggtcc
aaactcagttgttggaagagcacttgtggttcatgagctagaggatgacctcggaaagggtggacatgaacttagttcaa
ccactgggaatgcaggtggtagattggcatgcggtgtggttggtttgactcc
back to top