SOD, SOD (gene) Prunus persica

Gene Overview
Name SOD
Gene Symbol SOD
Type gene
Organism Prunus persica
Synonym CuZnSOD
manganese superoxide dismutase 1
Description superoxide:superoxide oxidoreductase
Comment PpCuZnSOD
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SODJX217743.1-SOD.m1Prunus persicamRNA
SODAJ238316.2-SOD.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
superoxide dismutaseSODPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JX217743.1-SOD.m1 scaffold_6:27243712..27245659
JX217743.1
mRNA parsed from NCBI nr database AJ238316.2-SOD.m1 N/A AJ238316.2

Sequence(s):
>JX217743.1-SOD.m1459
atggtgaagggcgttgctgttcttggctccagtgagggtgttaaaggaaccatcaacttcacccaagagggagatggccc
aactactgtgactggaagtatttctggcctcaagcctgggcttcatggtttccatgtccatgaatttggagacacaacca
acggttgcttgtcaactggaccgcatttcaatcctgatggcaagcaccatggtgcccctgaagacgagattcgccatgcc
ggtgatcttggaaatatcactgttggggacgatggaactgcaaacttcacaattattgacaagcagattcctctcgctgg
accacaatcaatcattggtagggcggttgttgtccatgcagaccctgatgacctgggcaagggtggacatgagcttagca
aaagcactggaaatgctggtggcaggactgcttgtggtattattggtctccaaaactga
back to top
>AJ238316.2-SOD.m1687
atggcactacgaaccctagtgagcagacggaccttagcaacagggctagggttccgccagcaactccgcggcttgcagac
cttttcgctccccgatctcccctacaactatggagcactggagccggcaattagcggtgacataatgcagctccaccacc
agaatcaccatcagacttacgtcaccaattacaataaagcccttgaacagctacatgacgccatttccaaaggagatgct
cctaccgtcgccaaattgcatagcgctatcaaattcaacggcggaggtcacattaaccactcgattttctggaagaatct
tgcccctgtccgcgagggtggtggtgagcctccaaagggttctcttggttgggctatcgacactaactttggctccctgg
aagctttagttcaaaagatgaatgcagaaggtgctgctttacagggttctggatgggtgtggctggctctagacaaagag
ttgaagaaacttgtggttgaaaccactgcaaatcaggacccattggttaccaaaggaccaactttagttccattgcttgg
tattgatgtttgggagcatgcgtactacttacagtataagaatgtgaggccagattatctcaagaacatatggaaagtaa
tcaactggaagtatgccagcgaagtgtacgagaaagaaagcccttga
back to top