Sa-RNase, Sa-RNase (gene) Prunus dulcis

Gene Overview
Name Sa-RNase
Gene Symbol Sa-RNase
Type gene
Organism Prunus dulcis
Synonym Sa-S-RNase
Sa-RNase
Description NA
Comment gametophytic self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sa-RNaseDQ150569.1-Sa-RNasePrunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sa-RNaseAF148465.1-Sa-RNase.m1Prunus dulcismRNA
Sa-RNaseDQ150569.1-Sa-RNase.m1Prunus dulcismRNA
Sa-RNaseAB026836.1-Sa-RNase.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ150569.1-Sa-RNase N/A DQ150569.1
mRNA parsed from NCBI nr database AF148465.1-Sa-RNase.m1 N/A AF148465.1
mRNA parsed from NCBI nr database DQ150569.1-Sa-RNase.m1 N/A DQ150569.1
mRNA parsed from NCBI nr database AB026836.1-Sa-RNase.m1 N/A AB026836.1

Sequence(s):
>DQ150569.1-Sa-RNase1632
atggcaatgttgaaattgtcactcgctttccatgttcttgcattcgtcctcttcttgtgtttcactatgagcactggtgg
gttgcattacaatcttttactctctatatcctataatatcacataatttgaattgcattttctacttctctattttatgt
ttggagaaatattgtgtgtgtactgttcgatgatatatatatatatatatatatatcaggtaacggaggactttgatcca
gcgcacaactttctttggctgagtaactacttgggaatttacctttctgcatgccgtctttcgtttattcttatggttgt
tgcaataagtgaagcggaaattatgttctttatatatctaatataccattagaagctttctataaaattgtaactccaaa
catactccgtaatttagtgagtaataaataaattttttataaaaattttatacaaccaatattggatcgggtcttgtctg
aaattaccacccctaagttgaacctaggatatatatatatttttttgattccctgaacctaggatattgagtgcatgatt
aaatgctcttaaccaagttacaaaccccttgcaatacttctttatatatatatatatatatataattttaaaaaatcagc
attaataaatgttttttagaaacacattaaataaatgtttaaaatattattaaaacatggcaacatttttaggagctcct
atagaagtttccctattattttaggaagtgaatagggagggagtacagttgaaatctcttttgttttttcaattcgtcct
taaattttgtctaactaagtagtttatggagtccattatagatttttttgaccttctcacaataatttttgcaggatcat
atcaatattttcagtttgtgcaacaatggccaccaaccacctgcgcagttagcaaacaaccttgctaccaaaacccgccc
tcaattttcaccatccatggcctatggccaagtaattattccaaaaaggcttgggtggcgaattgcactcggacgcgatt
taacaatagtttggtatgaattggctctttgtttttctagttactctttagttttttgtattttcctcacaatagattta
ttgcttggatgttgcaggctcctaaattggaagccaaactgaagatatcttggcccaacgtcgaaaatgccaattataca
gagttttgggaacgtgaatggaacaaacacggcacatgttccgagcaaacacttgaccaagaagaatacttccagcgatc
ccacgatatttggaacgcatacaatatcacaaatattcttaaaaaagctaatatcctaccaaatggggcaatatggaact
actcagacatagtatcaccaattaaaacagttactcgcaaaatgcccgcccttcgttgcaagcctgatccaacaaagcct
aaaaaccataagatctctcatcagctgttacatgaagtggtcctttgtctgcattataagggaagagctctgatagactg
taatcgcacagcatgcgacaataatcttaagatcttgtttcaataaattatagtcaagtatgacactgctgtaataaaaa
caaaagggaggattcttactttgaaatttagg
back to top
>AF148465.1-Sa-RNase.m1518
tattttaaatttgtgcaacaatggccaccaaccacctgcgcggttagcaaacaacctggctcccaaaacccgccctcaat
tttcaccatccatggcctatggccaagtaattattccaaaaaggctggggtggcaaattgcactcggacgcgatttaaca
atagtttggctcctaaattggaagccaaactgaagatatcttggcccaacgtcgaaaatgccaattatacagagttttgg
gaacgtgaatggaacaaacacggcacatgttccgagcaaacacttgaccaaaaagaatacttccagcgatcccacgatat
ttggaacgcatacaatatcacaaatttttttaaaaaagctaatatcctaccaaatggggcaatatggaactactcagaca
tagtatcaccaattaaaacagttactcgcaaaatgcccgcccttcgttgcaagcctgatccaacaaagcctaaaaaccat
aagatctctcatcagctgttacatgaagtggtcctttg
back to top
>DQ150569.1-Sa-RNase.m1681
atggcaatgttgaaattgtcactcgctttccatgttcttgcattcgtcctcttcttgtgtttcactatgagcacttcata
tcaatattttcagtttgtgcaacaatggccaccaaccacctgcgcagttagcaaacaaccttgctaccaaaacccgccct
caattttcaccatccatggcctatggccaagtaattattccaaaaaggcttgggtggcgaattgcactcggacgcgattt
aacaatagtttggctcctaaattggaagccaaactgaagatatcttggcccaacgtcgaaaatgccaattatacagagtt
ttgggaacgtgaatggaacaaacacggcacatgttccgagcaaacacttgaccaagaagaatacttccagcgatcccacg
atatttggaacgcatacaatatcacaaatattcttaaaaaagctaatatcctaccaaatggggcaatatggaactactca
gacatagtatcaccaattaaaacagttactcgcaaaatgcccgcccttcgttgcaagcctgatccaacaaagcctaaaaa
ccataagatctctcatcagctgttacatgaagtggtcctttgtctgcattataagggaagagctctgatagactgtaatc
gcacagcatgcgacaataatcttaagatcttgtttcaataa
back to top
>AB026836.1-Sa-RNase.m1684
atggcaatgttgaaattgtcactcgctttccatgttcttgcattcgtcctcttcttgtgtttcactatgagcactggatc
atatcaatattttcagtttgtgcaacaatggccaccaaccacctgcgcagttagcaaacaaccttgctaccaaaacccgc
cctcaattttcaccatccatggcctatggccaagtaattattccaaaaaggcttgggtggcgaattgcactcggacgcga
tttaacaatagtttggctcctaaattggaagccaaactgaagatatcttggcccaacgtcgaaaatgccaattatacaga
gttttgggaacgtgaatggaacaaacacggcacatgttccgagcaaacacttgaccaagaagaatacttccagcgatccc
acgatatttggaacgcatacaatatcacaaatattcttaaaaaagctaatatcctaccaaatggggcaatatggaactac
tcagacatagtatcaccaattaaaacagttactcgcaaaatgcccgcccttcgttgcaagcctgatccaacaaagcctaa
aaaccataagatctctcatcagctgttacatgaagtggtcctttgtctgcattataagggaagagctctgatagactgta
atcgcacagcatgcgacaataatcttaagatcttgtttcaataa
back to top