Sb-RNase, Sb-RNase (gene) Prunus dulcis

Gene Overview
Name Sb-RNase
Gene Symbol Sb-RNase
Type gene
Organism Prunus dulcis
Synonym Sb-S-RNase
Sb-RNase
Description NA
Comment gametophytic self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sb-RNaseAF148466.1-Sb-RNase.m1Prunus dulcismRNA
Sb-RNaseAB011469.1-Sb-RNase.m1Prunus dulcismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF148466.1-Sb-RNase.m1 N/A AF148466.1
mRNA parsed from NCBI nr database AB011469.1-Sb-RNase.m1 N/A AB011469.1

Sequence(s):
>AF148466.1-Sb-RNase.m1527
tattttcaatttgtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgaccttgctccaatccccggccact
acaatatttcaccatccatggcctatggccaagtaactattcaaacccaacgaagcccagtaattgcaatgggtcgcaat
ttaactttacgaaagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaatgataca
aggttttgggaaggcgaatggaacaaacatggtacatgttcggaaggttcacttaaccaaatgcaatacttcgagcgatc
ccacgaaacgtggtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaaacatgga
agtactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatccagcacag
aataagagcgggccgaagactcagttgttacatgaagtggtattttg
back to top
>AB011469.1-Sb-RNase.m1696
atggcgatgttgaagtcgtcccccgctttccttcttgttgcttttgctttcttcttgtgtttcattatgagcactggatc
ttatgtctattttcaatttgtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgaccttgctccaatcccc
ggccactacaatatttcaccatccatggcctatggccaagtaactattcaaacccaacgaagcccagtaattgcaatggg
tcgcaatttaactttacgaaagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaa
tgatacaaggttttgggaaggcgaatggaacaaacatggtacatgttcggaaggttcacttaaccaaatgcaatacttcg
agcgatcccacgaaatgtggtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggaagtactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatcc
agcacagaataagagcgggccgaagactcagttgttacatgaagtggtattttgttatgaatatcatgcgttaaagcaga
ttgactgtaatcgaacagcaggatgctggaataacgtcgacattaagttccaataa
back to top