Sc-RNase, Sc-RNase (gene) Malus x domestica

Gene Overview
Name Sc-RNase
Gene Symbol Sc-RNase
Type gene
Organism Malus x domestica
Synonym Sc-RNase precursor
Description rejection of pollen having Sc-allele
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sc-RNaseD50836.1-Sc-RNase.m1Malus x domesticamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database D50836.1-Sc-RNase.m1 N/A D50836.1

Sequence(s):
>D50836.1-Sc-RNase.m1687
atggggattacggggatgatatatatggttactatggtattttcattaattgtattaatattgtcttcccctacggtagg
atacgattattttcaatttacgcagcaatatcagccggctgtctgccactttaatcctactccttgtagagatcctcctg
acaagttgtttacggttcacggtttgtggccttcaaacagctcaggaaatgacccaatatactgcaagaatacaaccatg
aattctactaagatagcaaatctgacagcccggttggaaattatttggcccaacgtactcgatcgaaccgatcatataac
cttctggaataaacagtggaacaaacatggcagctgtgggcatcccgcaatacagaacgacatgcattatttgcaaacag
taatcaaaatgtacataacccagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggtggggaaattc
aggacacagaaggaaattgaaaaggccatacgcaaaggtaccaataataaggaacccaaactcaagtgccaaaagaatag
tcagaggactgaattggttgaggtcactatttgtagcgatcgcaacttaaaccagttcatagattgtccccgccctattt
taaatggatcacgatactactgccccaccaataatattctgtattaa
back to top