Sc-RNase, Sc-RNase (gene) Prunus armeniaca

Gene Overview
Name Sc-RNase
Gene Symbol Sc-RNase
Type gene
Organism Prunus armeniaca
Synonym self-incompatibility RNase Sc
Sc-RNase
Description NA
Comment Sc-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sc-RNaseEF101911.1-Sc-RNase.m1Prunus armeniacamRNA
Sc-RNaseDQ386735.1-Sc-RNase.m1Prunus armeniacamRNA
Sc-RNaseEF491874.1-Sc-RNase.m1Prunus armeniacamRNA
Sc-RNaseEF491873.1-Sc-RNase.m1Prunus armeniacamRNA
Sc-RNaseEF491872.1-Sc-RNase.m1Prunus armeniacamRNA
Sc-RNaseEF053409.1-Sc-RNase.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EF101911.1-Sc-RNase.m1 N/A EF101911.1
mRNA parsed from NCBI nr database DQ386735.1-Sc-RNase.m1 N/A DQ386735.1
mRNA parsed from NCBI nr database EF491874.1-Sc-RNase.m1 N/A EF491874.1
mRNA parsed from NCBI nr database EF491873.1-Sc-RNase.m1 N/A EF491873.1
mRNA parsed from NCBI nr database EF491872.1-Sc-RNase.m1 N/A EF491872.1
mRNA parsed from NCBI nr database EF053409.1-Sc-RNase.m1 N/A EF053409.1

Sequence(s):
>EF101911.1-Sc-RNase.m1157
tacttgttcttggttttgctttcttcttgtgtttcattatgagcactagatcttatgtctattttcaatttgtgcaacaa
tggccaccgaccacctgcagagttcgctggaaaccttgctccaaaccccggccattacaaaacttcaccatccatga
back to top
>DQ386735.1-Sc-RNase.m1130
ttgtgttcattatgagcactagatcttatgtctattttcaatttgtgcaacaatggccaccgaccacctgcagagttcgc
tggaaaccttgctccaaaccccggccattacaaaacttcaccatccatga
back to top
>EF491874.1-Sc-RNase.m1558
cttgttcttgcttttgctttcttcttgtgtctcattatgagcactagtggatcttatgtctattttcaatttgtgcaaca
atggccaccgaccacctgcggagttcgctggaaaccttgctccaaaccccggccattacaaatcttcaccatccatggcc
tatggccaagtaattattcaaacccaacgatgcccagttattgcactgggtcgcaatttaacgacaggaaagtgtaccct
caattgcggtccaaactgaagaggtcttggcccaacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaa
caaacatggtacatgttccgaacagacacttagccaaatgcagtacttcgagcgatcccatgcaatgtggtactcgcaca
atattacaaatatccttaagagcgcttcaatcgtaccacatccgacacagacatggaagtattcggacatagtatcagct
attaaaacagacactcaaagaacacccctccttcgttgcaaacgtgatccagcacagccgaactctcagtttttacat
back to top
>EF491873.1-Sc-RNase.m1558
cttgttcttggttttgctttcttcttgtgtttcattatgagcactagtggatcttatgtctattttcaatttgtgcaaca
atggccaccgaccacctgcagagttcgctggaaaccttgctccaaaccccggccattacaaatcttcaccacccatggcc
tatggccaagtaattattcaaacccaacgatgcccagtaattgcactgggtcgcaatttaacgacaggaaagtgtaccct
caattgcggtccaaactgaagaggtcttggcccaacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaa
caaacatggtacatgttccgaacagacacttaaccaaatgcagtacttcgagcgatcccatgcaatgtggtactcgcaca
atattacaaatatccttaagagcgcttcaatcgtaccacatccgacacagacatggaagtattcggacatagtatcagct
attaaaacagacactcaaagaacacccctccttcgttgcaaacgtgatccagcacagccgaactctcagtttttacat
back to top
>EF491872.1-Sc-RNase.m1558
cttgttcttgctttcgctttcttcttgtgtttcattatgagcgctagtggatcttatgtctattttcaatttgtgcaaca
atggccaccgaccacctgcagagttcgctggaaaccttgctccaaaccccggccattacaaatcttcaccatccatggcc
tatggccaagtaattattcaaacccaacgatgcccagtaattgcactgggtcgcaatttaacgacaggaaagtgtaccct
caattgcggtccaaactgaagaggtcttggcccaacgtggaaagtggcaatgatacaaaattttgggaaggcgaatggaa
caaacatggtacatgttccgaacagacacttaaccaaatgcagtacttcgagcgatcccatgcaatgtggtactcgcaca
atattacaaatatccttaagagcgcttcaatcgtaccacatccgacacagacatggaagtattcggacatagtatcagct
attaaaacagacactcaaagaacacccctccttcgttgcaaacgtgatccagcacagccgaactctcagtttttacat
back to top
>EF053409.1-Sc-RNase.m1567
atcgctttccttgttcttgcttttgctttcttcttgtgtctcattatgagcactagtggatcttatgtctattttcaatt
tgtgcaacaatggccaccgaccacctgcggagttcgctggaaaccttgctccaaaccccggccattacaaatcttcacca
tccatggcctatggccaagtaattattcaaacccaacgatgcccagttattgcactgggtcgcaatttaacgacaggaaa
gtgtaccctcaattgcggtccaaactgaagaggtcttggcccaacgtggaaagtggcaatgatacaaaattttgggaagg
cgaatggaacaaacatggtacatgttccgaacagacacttagccaaatgcagtacttcgagcgatcccatgcaatgtggt
actcgcacaatattacaaatatccttaagagcgcttcaatcgtaccacatccgacacagacatggaagtattcggacata
gtatcagctattaaaacagacactcaaagaacacccctccttcgttgcaaacgtgatccagcacagccgaactctcagtt
tttacat
back to top