Sc-RNase, Sc-RNase (gene) Prunus salicina

Gene Overview
Name Sc-RNase
Gene Symbol Sc-RNase
Type gene
Organism Prunus salicina
Synonym Sc-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sc-RNaseAB280791.1-Sc-RNasePrunus salicinagene
Sc-RNaseAB084144.1-Sc-RNasePrunus salicinagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sc-RNaseDQ790376.1-Sc-RNase.m1Prunus salicinamRNA
Sc-RNaseAB280791.1-Sc-RNase.m1Prunus salicinamRNA
Sc-RNaseAB084144.1-Sc-RNase.m1Prunus salicinamRNA
Sc-RNaseAB084102.1-Sc-RNase.m1Prunus salicinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus salicinagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB280791.1-Sc-RNase N/A AB280791.1
gene parsed from NCBI nr database AB084144.1-Sc-RNase N/A AB084144.1
mRNA parsed from NCBI nr database DQ790376.1-Sc-RNase.m1 N/A DQ790376.1
mRNA parsed from NCBI nr database AB280791.1-Sc-RNase.m1 N/A AB280791.1
mRNA parsed from NCBI nr database AB084144.1-Sc-RNase.m1 N/A AB084144.1
mRNA parsed from NCBI nr database AB084102.1-Sc-RNase.m1 N/A AB084102.1

Sequence(s):
>AB280791.1-Sc-RNase1939
atggcgatgttgaagtcgtcacccactttccttgttcttgctttcgctttcttcttgtgttttattatgagcactggtga
tggtgggttgcattacaatcttttgctctttatatcctacatgcatatatttagcattgcatttttctacttctatttga
tgtttaagaaatactgtgagtgttcgatgatatatcaggtaacgaaggacttgatctagctcacaacagtctttgggaat
tattattctattcatcattggaagctaaaactatgttatttacatcaaatccttatttaaggagcatttaccttctcaca
ataattttcgcaggatcttatgactattttcaatttgtgcaacagtggccaccggccacctgcagacttagcgggaaatc
ttgctccaaacctcggctacaaatcttcaccatccatggtctatggccaagtaactattcaaacccaaagattcccagta
attgcaagggggcgctatttgaggcaaggaaagtggtatgtacgcatttagtttttagaaaaattagattgtcacatgaa
gacaatatactttgttgataaaccttgggtgttagataaatcctgatgttgctcttctgcttgggaacattattttagat
atatacacctaagcacacatttatatttgtagctatattaatgtacctacctacctacctatacatttataaaagagtac
tcctattttcatccacccaccttatcttcaaaattttaaagagaaatttacccatttgtaaaatgacttctaaaaggact
tggggaaaaaagcctcaactcacgtaacccacctattctaccgtttgacaaaaagaagaagaagaagaagaaagcgcaat
agaaaattaccttcaaatgtataaatttctctttaaaacatttatccataatattttcaaaaactacaaggcatataatt
aaaaaactaaagatcctgaaaatcaaatattggactaaacatttattgagtccatcaaacacaacttgatcctctccata
tctcaattactaatgattagcaaagaaaatagcttgaattaataattaaagggtattttaggaataatggtgggtggaaa
gataagattgtattttttcaaatttacatggtgagtgggaaaataggacatggggtggaaataacagcactcttataaaa
atataagcgatgtcaacggagtctagcatagtgaaaaatgacattaacttgcaaacaacatgtctcgggttcgaccccga
tagcatcttcattttttgtgtgtgtgaaaaatcaccatctcctgtagtttagactatcttttgtactccaaaaaatgtaa
atgatcatctaattaaagcacctatcatatcgtgcttacgtatatatttaactattgtacatctaaatcaaaattcagta
caatactcaggtttaatatagaaaacaatctaattgaagaatggatgtatgtgttgcttggatgtctcagtaccctcagt
tgcaattgaacctgaagatatcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaagcgaatggaacaag
catggcacatgttctgaacggacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcgtacaatat
tacagagatccttaaaaatgcttcaatcgtaccacatccgacacaaacatggaagtacgcggacatagaattacccatta
aaacagcaactaaaagaacacccgtccttcgttgcaaacgtgatccagcacagaataagaccgggccaaagactcagttg
ttatatgaagtggtattttgttatgattatcatgcaaaaaggcaaattgactgtaaccgaacagaatgttggaataaagt
ggacatcaagtttcactaa
back to top
>AB084144.1-Sc-RNase531
ttgtgttttattatgagcactggtgatggatcttatgactattttcaatttgtgcaacagtggccaccggccacctgcag
acttagcgggaaatcttgctccaaacctcggctacaaatcttcaccatccatggtctatggccaagtaactattcaaacc
caaagattcccagtaattgcaagggggcgctatttgaggcaaggaaagtgtaccctcagttgcaattgaacctgaagata
tcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaagcgaatggaacaagcatggcacatgttctgaacg
gacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcgtacaatattacagagatccttaaaaacg
cttcaaccgtaccacatccgacacaaacatggaagtacgcggacatagaattacccattaaaacagcaactaaaagaaca
cccgtccttcgttgcaaacgtgatccagcacagaataagaccgggccaaag
back to top
>DQ790376.1-Sc-RNase.m185
tacttgttcttggttttgctttcttcttgtgttttattatgagcactggatcttatgactattttcaatttgtgcaacag
tggca
back to top
>AB280791.1-Sc-RNase.m1693
atggcgatgttgaagtcgtcacccactttccttgttcttgctttcgctttcttcttgtgttttattatgagcactggtga
tggttcttatgactattttcaatttgtgcaacagtggccaccggccacctgcagacttagcgggaaatcttgctccaaac
ctcggctacaaatcttcaccatccatggtctatggccaagtaactattcaaacccaaagattcccagtaattgcaagggg
gcgctatttgaggcaaggaaagtgtaccctcagttgcaattgaacctgaagatatcttggccggacgtaaaaagtggcaa
cgagacaaatttttggcaaagcgaatggaacaagcatggcacatgttctgaacggacactcaaccaaatgcaatacttcg
agcgatcagacgaaatgtggaactcgtacaatattacagagatccttaaaaatgcttcaatcgtaccacatccgacacaa
acatggaagtacgcggacatagaattacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacgtgatcc
agcacagaataagaccgggccaaagactcagttgttatatgaagtggtattttgttatgattatcatgcaaaaaggcaaa
ttgactgtaaccgaacagaatgttggaataaagtggacatcaagtttcactaa
back to top
>AB084144.1-Sc-RNase.m1531
ttgtgttttattatgagcactggtgatggatcttatgactattttcaatttgtgcaacagtggccaccggccacctgcag
acttagcgggaaatcttgctccaaacctcggctacaaatcttcaccatccatggtctatggccaagtaactattcaaacc
caaagattcccagtaattgcaagggggcgctatttgaggcaaggaaagtgtaccctcagttgcaattgaacctgaagata
tcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaagcgaatggaacaagcatggcacatgttctgaacg
gacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcgtacaatattacagagatccttaaaaacg
cttcaaccgtaccacatccgacacaaacatggaagtacgcggacatagaattacccattaaaacagcaactaaaagaaca
cccgtccttcgttgcaaacgtgatccagcacagaataagaccgggccaaag
back to top
>AB084102.1-Sc-RNase.m1639
ttgtgttttattatgagcactggtgatggatcttatgactattttcaatttgtgcaacagtggccaccggccacctgcag
acttagcgggaaatcttgctccaaacctcggctacaaatcttcaccatccatggtctatggccaagtaactattcaaacc
caaagattcccagtaattgcaagggggcgctatttgaggcaaggaaagtgtaccctcagttgcaattgaacctgaagata
tcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaagcgaatggaacaagcatggcacatgttctgaacg
gacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcgtacaatattacagagatccttaaaaatg
cttcaatcgtaccacatccgacacaaacatggaagtacgcggacatagaattacccattaaaacagcaactaaaagaaca
cccgtccttcgttgcaaacgtgatccagcacagaataagaccgggccaaagactcagttgttatatgaagtggtattttg
ttatgattatcatgcaaaaaggcaaattgactgtaaccgaacagaatgttggaataaagtggacatcaagtttcactaa
back to top