Se-RNase, Se-RNase (gene) Prunus dulcis

Gene Overview
Name Se-RNase
Gene Symbol Se-RNase
Type gene
Organism Prunus dulcis
Synonym self-incompatibility associated ribonuclease
Se-RNase
Description self-pollen rejection
Comment Se-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Se-RNaseDQ156216.1-Se-RNasePrunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Se-RNaseAF157008.2-Se-RNase.m1Prunus dulcismRNA
Se-RNaseAF177923.1-Se-RNase.m1Prunus dulcismRNA
Se-RNaseDQ156216.1-Se-RNase.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ156216.1-Se-RNase N/A DQ156216.1
mRNA parsed from NCBI nr database AF157008.2-Se-RNase.m1 N/A AF157008.2
mRNA parsed from NCBI nr database AF177923.1-Se-RNase.m1 N/A AF177923.1
mRNA parsed from NCBI nr database DQ156216.1-Se-RNase.m1 N/A DQ156216.1

Sequence(s):
>DQ156216.1-Se-RNase1235
tattctctaagtatggcgatgttgaaatcgtcactcgctttccttgttcttgctcttgctttcttcttttgttacgttat
gagcagtggtgggttgcattacaatgttttgctctttatatcctatacatgtacatataatcagcattgcatttttctaa
ttgtacgttttgttgagagaaactatattgtgtgtgttcgatgaatatcacatgacatgcgctattgaatccacccacat
atttttcatttaatctagccgtgcaatcaaccactttctttggatggagtatttggggattgcttttcctgcatgttctc
tttttattttgatcctcttttctttattatgctaattttgacaggatcttatgactattttcaatttgtgcaacaatggc
caccgaccaactgcagagttcgaacgaaatgctccaacccccggccattacaagtgttcaccatccatggcctatggcca
agtaattattcaaacccaacgatgcccagtaattgcaatgggtcacaatttgacgcaaggaaagtggtatgtactctttt
gtttttcacatactctttagcatttagttttcggaaaattagttgtcgcctaaagataatatacttttctatatataaac
atttattgttaaatattttttcagaaaattgggttgcattaatgtgagcatctaattaggatatgccaatttgtatttgg
ctatgtattcaaaatattgtatctaatgagagactcaaaatcaaaattctttagatactcaaaatcaatattcgatttaa
tactcatatttaatgaaataaaaattcttattcaaaaagacttacttatcccttgggttttcactttttctcaaaatatg
tctatattgcttggatgatgtctcagtcccctcaattgcgaaacaaactgaagagatcttggcccgacgtggaaagtggc
aacgatacaaaattttgggaaggcgaatggaacaaacacggtacatgttccgaacagacactcaaccaattccaatactt
cgagcgatcccaagacatgtggaggtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgctacac
aatcatggacctactcggatatagtagcacccattaaaacagctactaaaagaacacccctccttcgttgcaaatacgat
aagaagactcagttgttacatgaagtggtattttg
back to top
>AF157008.2-Se-RNase.m1666
atggggattttgaaatcgtcgctcgctttccttgttcttggctttgctttcttcttttgttacgttatgagcagtggatc
ttatgactattttcaatttgtccaacaatggccaccgaccaactgcagagttcgaacgaaatgctccaagccccggccat
tacaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgcccagtaattgcaatgggtcgaaattt
gatgacaggaacgtgtctcctcaattgcgaaacaaactgaaaagatcttggcccgacgtggaaagtggcaacgacacaaa
attttgggaaggcgaatggaacaaacacggtatatgttccgaacagacacttaaccaattccaatacttcgagcgatccc
aagacatgtggaaatcacacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgcgacacaaaattggaga
tactccgacatagtatcacccattaaaagagcaactaaaagaacacccatccttcgctgcaaacaggataagaagactca
gttgttacatgaagtggtattttgttatgaatataatgcgttaaagcagattgactgtaatcgaacatcaggatgctgga
atagtgttaacatctcgtttccataa
back to top
>AF177923.1-Se-RNase.m1486
caatttgtccaacaatggccaccgaccaactgcagagttcgaacgaaatgctccaagccccggccattacaatatttcac
catccatggcctatggccaagtaattattcaaacccaacgcccagtaattgcaatgggtcgaaatttgatgacaggaacg
tgtctcctcaattgcgaaacaaactgaaaagatcttggcccgacgtggaaagtggcaacgacacaaaattttgggaaggc
gaatggaacaaacacggtatatgttccgaacagacacttaaccaattccaatacttcgagcgatcccaagacatgtggaa
atcacacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgcgacacaaaattggagatactccgacatag
tatcacccattaaaagagcaactaaaagaacacccatccttcgctgcaaacaggataagaagactcagttgttacatgaa
gtggta
back to top
>DQ156216.1-Se-RNase.m1587
atggcgatgttgaaatcgtcactcgctttccttgttcttgctcttgctttcttcttttgttacgttatgagcagtggatc
ttatgactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgaacgaaatgctccaacccccggccat
tacaagtgttcaccatccatggcctatggccaagtaattattcaaacccaacgatgcccagtaattgcaatgggtcacaa
tttgacgcaaggaaagtgtcccctcaattgcgaaacaaactgaagagatcttggcccgacgtggaaagtggcaacgatac
aaaattttgggaaggcgaatggaacaaacacggtacatgttccgaacagacactcaaccaattccaatacttcgagcgat
cccaagacatgtggaggtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaagtgctacacaatcatgg
acctactcggatatagtagcacccattaaaacagctactaaaagaacacccctccttcgttgcaaatacgataagaagac
tcagttgttacatgaagtggtattttg
back to top