Sf-RNase, Sf-RNase (gene) Prunus dulcis

Gene Overview
Name Sf-RNase
Gene Symbol Sf-RNase
Type gene
Organism Prunus dulcis
Synonym self-incompatibility associated ribonuclease
Sf-RNase
Description NA
Comment Sf-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sf-RNaseAB433984.1-Sf-RNasePrunus dulcisgene
Sf-RNaseDQ156217.1-Sf-RNasePrunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sf-RNaseAF157009.1-Sf-RNase.m1Prunus dulcismRNA
Sf-RNaseAB433984.1-Sf-RNase.m1Prunus dulcismRNA
Sf-RNaseDQ156217.1-Sf-RNase.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB433984.1-Sf-RNase N/A AB433984.1
gene parsed from NCBI nr database DQ156217.1-Sf-RNase N/A DQ156217.1
mRNA parsed from NCBI nr database AF157009.1-Sf-RNase.m1 N/A AF157009.1
mRNA parsed from NCBI nr database AB433984.1-Sf-RNase.m1 N/A AB433984.1
mRNA parsed from NCBI nr database DQ156217.1-Sf-RNase.m1 N/A DQ156217.1

Sequence(s):
>AB433984.1-Sf-RNase1725
atggggattttgaaatcgtcactcggttttcttgttcttgcttttgctttcttcttgtgtttcattatgagcactagtgg
tgatggtgggttgcattacaagctttggttctttatatcccatatatacgtgcatatgcataattatagcattgcatttt
tctacttctattttatttttagaataatattgtgtgtgttcgatgatataataataacaggtaaccgagggcttgatcta
gcccacaaatttctttggatgagtaactatttgcagaattctttcgtttactctgctagttattgcaataagtgcattat
tcatcattggaagcaaaaactatgttctttacacatcaaatccttatttaagttaaaactttaattaaccttctcacaaa
cttttcgcaggatcttatgtctatttacaatttgtgcaacaatggccaccgaccacctgcagatttagcggcaaaccttc
caacaaccgccgtccattaccaattttcaccatccatggcatatggccaagtaattattcaaacccaaggatgcgcagta
attgcactgggtcgcaatttaaaaaaatattggtatgtattgtgtttgtttttttttaacgtactatttggcatttagtt
tttaaaaaattagattgtcatctgaagacaatgtacttctttttcaacaaacttgggtgttatctaggtgcaaattgtaa
gtacaattatattcttaggtatattaatgcaactagtcatgcatttatttcatgtgccctatctaatttgttgacatatg
tcattccactaacttttaaacttaacactggtaacttttaatacaattagaaaaacaaaaattaattattaaagaaataa
caaaaatccaacagccatcacaacaccccacccacccaattaacctggtcagccaccccaccccactggcggcaaagccc
ctctcttcccatatcctattagaagttagtgggagtgacaggtgtcggggacagggagaggggcacaagaaaattggact
atttacaatcatcttaaaggacctaccattttgtactaataccgtacctaaataaatagtcaaaattataatttaattta
acgctcaggtttaatgaaaaaaacaatttattcaagaatgaagatctatctatatcttaagtctgtactttttctcaaaa
tctttagttttcactctttctaaaaaaatgtctaatatatcttggatgtctcagtcccctcggttgcgatccaaactgga
gagagcttggccagacgtggaaagtggcaatgatacaaaattttgggaagacgagtggaacaaacatggcaaatgttccg
aacagacacttaaccaaatgcaatacttcgagcgatcccaccaaatgtggagctcgttcaatattacaaatatacttgaa
aaggcttcaatcgtaccaaatgcgacacaaacatggacctactcggacatattatcacccattaaagcagcaactcaaag
aatacccctccttcgttgcaaaggaaatccacagcgccaggcgaagtctcagcctaagaatcgggggaagtctcagccta
agagccaagcgacgactcagtttttacatgaagtggtattgtgttatgaatataatgcgttaaagctgattgactgtaat
cgaacagcaggatgctggaataacgttgacattaagtttcattaa
back to top
>DQ156217.1-Sf-RNase2004
tattctctaagtatggcgatgttgaagtcgtcccccgctttccttcttgttgcttttgctttcttcttgtgtttcattat
gagcactggtgggttgcattacaatcttttactctctatatcctataatatcacataatttgaattgcattttctacttc
tctattttatgtttggagaaatattgtgtgtgtactgttcgatgatatatatatatatatatatatatcaggtaacggag
gactttgatccagcgcacaactttctttggctgagtaactacttgggaatttacctttctgcatgccgtctttcgtttat
tcttatggttgttgcaataagtgaagcggaaattatgttctttatatatctaatataccattagaagctttctataaaat
tgtaactccaaacatactccgtaatttagtgagtaataaataaattttttataaaaattttatacaaccaatattggatc
gggtcttgtctgaaattaccacccctaagttgaacctaggatatatatatatttttttgattccctgaacctaggatatt
gagtgcatgattaaatgctcttaaccaagttacaaaccccttgcaatacttctttatatatatatatatatatatataat
tttaaaaaatcagcattaataaatgttttttagaaacacattaaataaatgtttaaaatattattaaaacatggcaacat
ttttaggagctcctatagaagtttccctattattttaggaagtgaatagggagggagtacagttgaaatctcttttgttt
ttttcaattcgtccttaaattttgtctaactaagtagtttatggagtccattatagatttttttgaccttctcacaataa
tttttgcaggatcttatgtctattttcaatttgtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgacct
tgctccaatccccggccactacaatatttcaccatccatggcctatggccaagtaactattcaaacccaacgaagcccag
taattgcaatgggtcgcaatttaactttacgaaagtggtatgtattatttcaaattttttttttttcacttactctttag
cttttattgtttttattttttgcacaaatactctttagcattttagtttttagaaaattagattgtcgtatgaagattta
aaatttaattaaaatttttttttcaataagccttgggggttagatataaaattttggtgttggtttagtttttttaatta
ttatttttttaatgttggttcttagttagacacattattttgaaaatatagtcaagttcaaaatggtacgtatatttata
tttatatgcatattaatgtacttgcgaaaatatgatggatctgctcatctaattacatgacctaccattttgtcctaatg
tatatatgcaaaaaatttgttagaagaaaaagcaaggctataatatattattgaagggtgaactcaaaattcaatttaat
gctcagatttaaagaaccaaaaaaaaaaaaaaatcttattcaagaatgaaaatctaattatcatttattcaatttacttt
ttctgaaaatatgtgtctatattgcttggatgtctcagtcccctaaaatgcgagtcaaactgaagagatcttggcccgac
gtggaaagtggcaatgatacaaggttttgggaaggcgaatggaacaaacatggtacatgttcggaaggttcacttaacca
aatgcaatacttcgagcgatcccacgaaatgtggtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtac
cacatccgacacaaacatggaagtactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgt
tgcaaacctgatccagcacagaataagagcgggccgaagactcagttgttacatgaagtggtatttgttatgaatatcat
gcgt
back to top
>AF157009.1-Sf-RNase.m1549
caatttgttcagcagtggccaccgaccacctgcagatttagcggcaaaccttccaacaaccgccgtccattaccaatttt
caccatccgtggcgtatggccaagtaattattcaaacccaaggatgcgcagtaattgcactgggtcgcaatttaaaaaaa
tattgtcccctcggttgcgatccaaactggagagagcttggccagacgtggaaagtggcaatgatacaaaattttgggaa
gacgagtggaacaaacatggcaaatgttccgaacagacacttaaccaaatgcaatacttcgagcgatcccaccaaatgtg
gagctcgttcaatattacaaatatacttgaaaaggcttcaatcgtaccaaatgcgacacaaacatggacctactcggaca
tattatcacccattaaagcagcaactcaaagaatacccctccttcgttgcaaaggaaatccacagcgccaggcgaagtct
cagcctaagaatcgggggaagtctcagcctaagagccaagcgacgactcagttgttacatgaagtggta
back to top
>AB433984.1-Sf-RNase.m1738
atggggattttgaaatcgtcactcggttttcttgttcttgcttttgctttcttcttgtgtttcattatgagcactagtgg
tgatggatcttatgtctatttacaatttgtgcaacaatggccaccgaccacctgcagatttagcggcaaaccttccaaca
accgccgtccattaccaattttcaccatccatggcatatggccaagtaattattcaaacccaaggatgcgcagtaattgc
actgggtcgcaatttaaaaaaatattgtcccctcggttgcgatccaaactggagagagcttggccagacgtggaaagtgg
caatgatacaaaattttgggaagacgagtggaacaaacatggcaaatgttccgaacagacacttaaccaaatgcaatact
tcgagcgatcccaccaaatgtggagctcgttcaatattacaaatatacttgaaaaggcttcaatcgtaccaaatgcgaca
caaacatggacctactcggacatattatcacccattaaagcagcaactcaaagaatacccctccttcgttgcaaaggaaa
tccacagcgccaggcgaagtctcagcctaagaatcgggggaagtctcagcctaagagccaagcgacgactcagtttttac
atgaagtggtattgtgttatgaatataatgcgttaaagctgattgactgtaatcgaacagcaggatgctggaataacgtt
gacattaagtttcattaa
back to top
>DQ156217.1-Sf-RNase.m1630
atggcgatgttgaagtcgtcccccgctttccttcttgttgcttttgctttcttcttgtgtttcattatgagcactggatc
ttatgtctattttcaatttgtgcaacaatggccaccgacaaactgcagagttcgcatcaagcgaccttgctccaatcccc
ggccactacaatatttcaccatccatggcctatggccaagtaactattcaaacccaacgaagcccagtaattgcaatggg
tcgcaatttaactttacgaaagtgtcccctaaaatgcgagtcaaactgaagagatcttggcccgacgtggaaagtggcaa
tgatacaaggttttgggaaggcgaatggaacaaacatggtacatgttcggaaggttcacttaaccaaatgcaatacttcg
agcgatcccacgaaatgtggtactcgttcaatattacagaaatccttaaaaacgcttcaatcgtaccacatccgacacaa
acatggaagtactcagacatagtagcacccattaaaacagcaactaaaagaacacccgtccttcgttgcaaacctgatcc
agcacagaataagagcgggccgaagactcagttgttacatgaagtggtatttgttatgaatatcatgcgt
back to top