Si-RNase, Si-RNase (gene) Malus x domestica

Gene Overview
Name Si-RNase
Gene Symbol Si-RNase
Type gene
Organism Malus x domestica
Synonym SIR2-family protein
Si-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Si-RNaseAY347835.1-Si-RNase.m1Malus x domesticamRNA
Si-RNaseAB052683.1-Si-RNase.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY347835.1-Si-RNase.m1 Chr00:19234227..19235784
chr1:1217187..1218744
AY347835.1
mRNA parsed from NCBI nr database AB052683.1-Si-RNase.m1 N/A AB052683.1

Sequence(s):
>AY347835.1-Si-RNase.m1327
gactacagaagccccaatggagcttatagttctggattcaacccaattacccatcaggagtttcttcgttctaatcggac
ccgaaggcgatattgggcaaggagttatgctggatggagacgatttactgctgtagagcctggttcagctcatatttctt
tagcatctctagaaaaagctggccggataaattttatgattacacaagatgttgataggttgcatcaccgtgctggtagt
aacccggtcgaattacatggaacagtatattctgtcatttgtatagactgtggtttttccttcccccggaatccatttca
agaccaa
back to top
>AB052683.1-Si-RNase.m1687
atggggattacagggatgatatatatggttacaatggtattttcattaattgtattaatgttgtcttcgtccgcggtgaa
attcgattattttcaatttacgcagcaatatcagccggctgtctgcaactctaatcctactccttgtaaggatcctccgg
acaagttgtttacggttcatggtttgtggccttcaaatgttaatggaagtgaccccaagaaatgcaaagctacaatctta
aatcctcaaacgataacaaatcttaaagcccagctggaaattatttggccaaacgtactcaatcgaagggctcatgtacg
cttctggcgtaaacagtggcgtaaacatggcgcctgtgggtaccccacaatagcggacgacatgcattactttagcacag
taatcgaaatgtacataaccaagaaacaaaacgtctctgaaatcctctcaaaggcgaagattaaaccggaggggagattc
aggacacgggacgacattgtaaatgccataagccaaagtatcgactataagaaaccaaaactcaagtgcaagatcaataa
tcagacaactgaattggttgaggtcggtctttgcagcgataacaacttaacgcagttcataaattgccccaacccatttc
ctcaaggatcaccatatttctgccccaccaataatattcagtattaa
back to top