CBF4, HQ910515.1-CBF4.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameHQ910515.1-CBF4.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBF4CBF4Fragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ910515.1-CBF4.m1-cds1HQ910515.1-CBF4.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBF4HQ910515.1-CBF4.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
HQ910515 region HQ910515:1..595+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductC-repeat binding factor 4
Genbank noteCBF4
The following sequences are available for this feature:

mRNA sequence

>HQ910515.1-CBF4.m1 ID=HQ910515.1-CBF4.m1|Name=CBF4|organism=Fragaria x ananassa|type=mRNA|length=595bp
back to top

protein sequence of CBF4

>HQ910515.1-CBF4.p1 ID=HQ910515.1-CBF4.p1|Name=CBF4|organism=Fragaria x ananassa|type=polypeptide|length=198bp
back to top

mRNA from alignment at HQ910515:1..595+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ910515.1-CBF4.m1 ID=HQ910515.1-CBF4.m1|Name=CBF4|organism=Fragaria x ananassa|type=mRNA|length=595bp|location=Sequence derived from alignment at HQ910515:1..595+ (Fragaria x ananassa)
atgctcgagtcttcttctcactccgataacaacagcggcggcgttgggcg gatggccttgtcagacgaggaggtcatgctggcggagacgtacccgaaga agagggcgggaaggaagaagttcaaggagacgaggcacccggtttaccgc ggtgtgaggaggagaaactccggcaagtgggtttgcgaggttcgtgagcc gaacaagaagacgaggatttggcttgggactttccccactaccgaaatgg ctgcgcgtgcccacgacgtggcggcgattgccttgaggggccggaatgcg tgtttgaactttgccgactcggcgtggcggctgccggtgccggcttctaa tagtgctaaggacatacagacggcggctgctgaggcggcggaggcgtttc ggcctaataggggggaatcggaagttgtgtcgaaagcgacggaggcggtg gaagaggaatcggaacaaccggtgttttatatggacgaggaggatgtgtt tgggatgccggggttgctggccaacatggcggaagggatgctactgccgc ctcctcactataacggatacggaggagacgaatatgaagggcgaa
back to top

Coding sequence (CDS) from alignment at HQ910515:1..595+

>HQ910515.1-CBF4.m1 ID=HQ910515.1-CBF4.m1|Name=CBF4|organism=Fragaria x ananassa|type=CDS|length=595bp|location=Sequence derived from alignment at HQ910515:1..595+ (Fragaria x ananassa)
back to top