Sp-RNase, Sp-RNase (gene) Pyrus communis

Gene Overview
Name Sp-RNase
Gene Symbol Sp-RNase
Type gene
Organism Pyrus communis
Synonym Sp-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePyrus communisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sp-RNaseAB258364.1-Sp-RNase.m1Pyrus communismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB258364.1-Sp-RNase.m1 N/A AB258364.1

Sequence(s):
>AB258364.1-Sp-RNase.m1684
atggggattacggggatgatatatattgttacgatggtattttcattaattgtattaatattgtcttcctctacggtggg
atacgattattttcaatttacgcagcaatatcagccagctgtctgcagatctaatcctactccttgtaaggatcctactg
acaagttgtttacggttcacggtttgtggccttcaaatttgaatggacctcacccagcaaattgcacgaatgcaaccgtg
aattctcacaggataaaaaatatcgaagcccagttgaaaattatttggccgaacgtactcgatcgaaccaaccatgtagg
cttctggaataaacagtggataaaacatggcagctgtgggaatcctccaataatgaacgacacgcattactttcaaacag
taatcaacatgtacataacccggaaacaaaacgtctctggaatcctctcaaaggcgaagattgaaccagtggggttgaaa
aggccactggtagatattgaaaatgccatacggaatagtaccaacaataagaaaccaaaattcaagtgccaaacgaagaa
tagggtgactgaattggttgagatcagtctttgcagcgatggcagcttaacgcagttcataaattgcccccgcccatttc
caccaggatcaccatttctctgccctgccgatattgagtattaa
back to top