St-RNase, St-RNase (gene) Malus transitoria

Gene Overview
Name St-RNase
Gene Symbol St-RNase
Type gene
Organism Malus transitoria
Synonym St-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
St-RNaseAB052268.1-St-RNaseMalus transitoriagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
St-RNaseAB052268.1-St-RNase.m1Malus transitoriamRNA
St-RNaseAB035928.1-St-RNase.m1Malus transitoriamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNaseMalus transitoriagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB052268.1-St-RNase N/A AB052268.1
mRNA parsed from NCBI nr database AB052268.1-St-RNase.m1 N/A AB052268.1
mRNA parsed from NCBI nr database AB035928.1-St-RNase.m1 N/A AB035928.1

Sequence(s):
>AB052268.1-St-RNase161
ctggctgtctgcaactctaatcgtactctttgtaaggatcctcctgacaagttgttcacggttcacggtttgtggccttc
aagcatggtaggacctgacccaagtaaatgcccgataaagaatattcggaagagagaaaaattactcgaaccccagctgg
a
back to top
>AB052268.1-St-RNase.m1161
ctggctgtctgcaactctaatcgtactctttgtaaggatcctcctgacaagttgttcacggttcacggtttgtggccttc
aagcatggtaggacctgacccaagtaaatgcccgataaagaatattcggaagagagaaaaattactcgaaccccagctgg
a
back to top
>AB035928.1-St-RNase.m1678
atgtcgaggatggtatatgtggttacgatggtatttttattaattgtgttaatattgtcttcgtccacggtgggatacga
ttattttcaatttacgcagcaatatcagctggctgtctgcaactctaatcgtactctttgtaaggatcctcctgacaagt
tgttcacggttcacggtttgtggccttcaagcatggtaggacctgacccaagtaaatgcccgataaagaatattcggaag
agagaaaaattactcgaaccccagctggaaattatttggccgaacgtattcgatcgaaccaaaaataacctgttctggga
taaagagtggatgaaacatggctcctgtgggtatcccacaatagataacgagaaccactactttgaaaccgtaatcaaaa
tgtacatcaccaagaaacaaaacgtctctgaaatcctctcaaaggcgaagattgaaccggatgggaaaaaaagaacactg
ttggatattgaaaatgccatacgcaatggtgccgacaataagaaaccaaagctcaagtgtcaaaagaagggtaggatgac
tgaattggttgaggtcactctttgcagtgataaaagcggagaacatttcatagattgcccccacccctttgaaccaatat
caccacatttttgccccaccaacaatatcaagtattaa
back to top