ABI4, JQ860115.1-ABI4.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameJQ860115.1-ABI4.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ABI4ABI4Pyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ860115.1-ABI4.m1-cds1JQ860115.1-ABI4.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ABI4JQ860115.1-ABI4.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ860115 region JQ860115:1..634+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductABI4 protein
The following sequences are available for this feature:

mRNA sequence

>JQ860115.1-ABI4.m1 ID=JQ860115.1-ABI4.m1|Name=ABI4|organism=Pyrus pyrifolia|type=mRNA|length=634bp
back to top

protein sequence of ABI4

>JQ860115.1-ABI4.p1 ID=JQ860115.1-ABI4.p1|Name=ABI4|organism=Pyrus pyrifolia|type=polypeptide|length=210bp
back to top

mRNA from alignment at JQ860115:1..634+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ860115.1-ABI4.m1 ID=JQ860115.1-ABI4.m1|Name=ABI4|organism=Pyrus pyrifolia|type=mRNA|length=634bp|location=Sequence derived from alignment at JQ860115:1..634+ (Pyrus pyrifolia)
ccacccaaaccctaagacctcttctcccccgcccgtcgggcttcagcctt actctgccctactcctcctctgcccacccggtcccgctcatggattcggg cttcgttccatacggtgttggcttagggttaggagtctaccataacgttg ctgctgctgcggccgtcgccggttgtggtgcaacttcgtccgtacgtatg aatcagcatcctcatcacatgttagatcaagatcatgagtatcaaaacaa cattaatcgtttgcaccaacaacaacagcaacatcagcagcaacaaattg tggtgcaacaatttcatcatcagtaccccatcgcattatccgacggcagc ggttgtgacacatcaacctcgaatcaatatccaaaccctagtcacgatca ataccaactacaactacaccatcagaataacaataatctggagtgttgtt cgtacgacgatgtcatgaattcgcttgtgggatcagggttgtctacggag cctatggcggttgcaccggggtgttctgacattccgatggggggagtggg gcccatttcgccgtcgatgtggccactgacaagcgaggaagagtgcgttc cgagtctttgggactacgacgatcctttcttctt
back to top

Coding sequence (CDS) from alignment at JQ860115:1..634+

>JQ860115.1-ABI4.m1 ID=JQ860115.1-ABI4.m1|Name=ABI4|organism=Pyrus pyrifolia|type=CDS|length=634bp|location=Sequence derived from alignment at JQ860115:1..634+ (Pyrus pyrifolia)
back to top