MYB4, JX013493.1-MYB4.m1 (mRNA) Malus hybrid cultivar

Transcript Overview
Unique NameJX013493.1-MYB4.m1
OrganismMalus hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
MYB4MYB4Malus hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JX013493.1-MYB4.m1-cds1JX013493.1-MYB4.m1-cds1Malus hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MYB4JX013493.1-MYB4.p1Malus hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JX013493 region JX013493:1..993+ NCBI Rosaceae gene and mRNA sequences
Chr03 chromosome Chr03:37292133..37296193+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr3 chromosome chr3:33338364..33342365+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr3 chromosome chr3:33335812..33339871+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr3 chromosome chr3:39056153..39060154+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Genbank noteMcMYB4
The following sequences are available for this feature:

mRNA sequence

>JX013493.1-MYB4.m1 ID=JX013493.1-MYB4.m1|Name=MYB4|organism=Malus hybrid cultivar|type=mRNA|length=993bp
back to top

protein sequence of MYB4

>JX013493.1-MYB4.p1 ID=JX013493.1-MYB4.p1|Name=MYB4|organism=Malus hybrid cultivar|type=polypeptide|length=330bp
back to top

mRNA from alignment at JX013493:1..993+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JX013493.1-MYB4.m1 ID=JX013493.1-MYB4.m1|Name=MYB4|organism=Malus hybrid cultivar|type=mRNA|length=993bp|location=Sequence derived from alignment at JX013493:1..993+ (Malus hybrid cultivar)
atggggagggcgccgtgctgtgagaaagtcggtctcaagaagggaaggtg gacggcggaggaggatgaaatcttactcaattatatccaggccaatgggg aaggctcctggaggtctttacccaagaatgcagggttgctgcggtgtgga aagagttgcagactgagatggataaattatctgagagctgacttaaagag gggaaatatttcttctcaagaggaagatatcatcatcaaattgcatgctt ctttgggtaataggtggtctttgatagcgagtcaattaccaggaagaacc gacaatgaaataaagaactactggaactctcacttgagcagaaaaattgg caccttcaggaggcctgccaccaccaccgtcattactactgaaattagca ccagttccccaccagccggtgatgaagtttccgcagctatggaattaggc cctcccaaaagaaggggcggcagaaccagtcgctgggccatgaagaagaa caaaacctactctaccaccaaacccaaaggcctcaaggcccggctgaggc agagccaccacaaacacgataatattgctgctgctgctgctgatgatgat cgtctcaataatgcccacgaggcaattgccttgcctactaaaagtaataa taaaaacgtggacaccatgcaggacggttacgtgctactaatggaggtcc cggaccagcagcaggaaactagaggtggaggaatagcaatgccggcaaca gtcattgatcatcagaaagaaactgatggcgaaaaactaattttaggacc acatccacatggacatgacgacgatgatatgaatgaatatgtcggcatta atggagggttgttgggttttactgactacttgatggacgacattaatgag gacgagatactggatccaaatggggttatggctttaagttcaagtgaaat aacattcatcaagatgctgatcattttcccggacgcgttatag
back to top

Coding sequence (CDS) from alignment at JX013493:1..993+

>JX013493.1-MYB4.m1 ID=JX013493.1-MYB4.m1|Name=MYB4|organism=Malus hybrid cultivar|type=CDS|length=993bp|location=Sequence derived from alignment at JX013493:1..993+ (Malus hybrid cultivar)
back to top