DREB2, JN204427.1-DREB2.m1 (mRNA) Malus prunifolia

Transcript Overview
Unique NameJN204427.1-DREB2.m1
OrganismMalus prunifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB2DREB2Malus prunifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JN204427.1-DREB2.m1-cds1JN204427.1-DREB2.m1-cds1Malus prunifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB2JN204427.1-DREB2.p1Malus prunifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JN204427 region JN204427:99..956+ NCBI Rosaceae gene and mRNA sequences
Chr12 chromosome Chr12:7986305..7987162- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr12 chromosome chr12:6886609..6887466- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr12 chromosome chr12:6872822..6873679- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr12 chromosome chr12:8236490..8237347+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productdehydration-responsive element binding protein
The following sequences are available for this feature:

mRNA sequence

>JN204427.1-DREB2.m1 ID=JN204427.1-DREB2.m1|Name=DREB2|organism=Malus prunifolia|type=mRNA|length=858bp
back to top

protein sequence of DREB2

>JN204427.1-DREB2.p1 ID=JN204427.1-DREB2.p1|Name=DREB2|organism=Malus prunifolia|type=polypeptide|length=285bp
back to top

mRNA from alignment at JN204427:99..956+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JN204427.1-DREB2.m1 ID=JN204427.1-DREB2.m1|Name=DREB2|organism=Malus prunifolia|type=mRNA|length=858bp|location=Sequence derived from alignment at JN204427:99..956+ (Malus prunifolia)
atggataacagcagaaaatctccgttgaagccttggaagaaaggcccgac gagaggcaaaggcggccctcagaacgcctcctgcgaataccgcggcgttc ggcaaagaacttggggcaaatgggtggctgaaatcagagagcctaagaag agaaccaggctgtggctgggctcttttgctacggctgaggaagctgccat ggcctatgacgatgctgccaggagactctacggccccgaagcttttctca accttcctcaccttcaacccagctccaatccttcactcaaatctcaaaaa ttcaagtggttcccttcccacaacttcatttccatgtttccttcgtgcgg tttgctcaacatcaatgcgcagccgagcgttcatgtcattcatcagaggc tccaagaacttaagcaaaatggggttcttggtcacaccaccccttcctct agttcttcctcctgtgattcaaaatctgaggctcacatcctgagtgacaa aaccgagatgcgaaatgttgcagagaaggagaaggatgtcgaaatttcat ctgaaaaagaggcggaagactaccaggagaagccacagatggatctcaat gagtttcttcagcaactgggagtactgaacaaggagacacaatcagaggc aactgagacaacagaaagttttacagctccggaattttcgatcggagaag ttcatgatgaattcggaccctttgctgacaagaatatcaattgggatgca ttgattgagatgcacgggatttcaaaccaaggagcagatgctggtacctt tcaagtttacgatatgaatgaagagccttccttccccacttccatttgga acttctaa
back to top

Coding sequence (CDS) from alignment at JN204427:99..956+

>JN204427.1-DREB2.m1 ID=JN204427.1-DREB2.m1|Name=DREB2|organism=Malus prunifolia|type=CDS|length=858bp|location=Sequence derived from alignment at JN204427:99..956+ (Malus prunifolia)
back to top