ANR, JQ068825.1-ANR.m1 (mRNA) Rubus hybrid cultivar

Transcript Overview
Unique NameJQ068825.1-ANR.m1
OrganismRubus hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRRubus hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ068825.1-ANR.m1-cds1JQ068825.1-ANR.m1-cds1Rubus hybrid cultivarCDS
JQ068825.1-ANR.m1-cds2JQ068825.1-ANR.m1-cds2Rubus hybrid cultivarCDS
JQ068825.1-ANR.m1-cds3JQ068825.1-ANR.m1-cds3Rubus hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRJQ068825.1-ANR.p1Rubus hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ068825 region JQ068825:1..726+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Genbank noteanthocyanidin reductase
The following sequences are available for this feature:

mRNA sequence

>JQ068825.1-ANR.m1 ID=JQ068825.1-ANR.m1|Name=ANR|organism=Rubus hybrid cultivar|type=mRNA|length=570bp
back to top

protein sequence of ANR

>JQ068825.1-ANR.p1 ID=JQ068825.1-ANR.p1|Name=ANR|organism=Rubus hybrid cultivar|type=polypeptide|length=190bp
back to top

mRNA from alignment at JQ068825:1..726+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ068825.1-ANR.m1 ID=JQ068825.1-ANR.m1|Name=ANR|organism=Rubus hybrid cultivar|type=mRNA|length=726bp|location=Sequence derived from alignment at JQ068825:1..726+ (Rubus hybrid cultivar)
ccagagaacgatatgattaaaccaggagtccaaggagtactaaacgttct gaaatcatgtgtcaaagccaagacagtcaaacgcgtcgttttgacatcat cagcagctgcagtgactgtcaatactctcactggaacaggcttgatcgtg gacgaaaatgattggtctgatgttgagttcttgaccactgccaagccacc tacttgggtaaatcacataattgttttaggctataacattaaatgttttc tgaaatgaatgaactaggtgatcaaacaaaagcttttcctcaaatgttca ggggtatcctgtttccaaggtactagctgagaagacagcttggaaattcg ccgaagaaaataacattgatctcatcactgtgatcccttctctgatggct ggtgctagtctcactccagatatccccagcagtattggcctcgccacgtc tttaattacaggtaagaaatcaggtggtggaatatgttacatgtccatat tagcatcgcggtgttctaatggtactcttttacaggaaatgaattcctca taaatggcttgaaaggcatgcaaatgctatcaggttctatatccattaca catgtggaagatgtctgccgagctcatatatttttggcagagaaagaatc tgcttctggtcggtacatatgctgcgctgcaaatagcggtgttcctgagc ttgcaaaatttctgaacaagagatac
back to top

Coding sequence (CDS) from alignment at JQ068825:1..726+

>JQ068825.1-ANR.m1 ID=JQ068825.1-ANR.m1|Name=ANR|organism=Rubus hybrid cultivar|type=CDS|length=570bp|location=Sequence derived from alignment at JQ068825:1..726+ (Rubus hybrid cultivar)
back to top