DREB6-1, JQ669822.1-DREB6-1.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameJQ669822.1-DREB6-1.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB6-1DREB6-1Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ669822.1-DREB6-1.m1-cds1JQ669822.1-DREB6-1.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB6-1JQ669822.1-DREB6-1.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ669822 region JQ669822:1..1353+ NCBI Rosaceae gene and mRNA sequences
Chr09 chromosome Chr09:32316315..32317682- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr9 chromosome chr9:28032049..28033401- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr9 chromosome chr9:31402105..31403457- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productdehydration-responsive element-binding protein (DREB6)
The following sequences are available for this feature:

mRNA sequence

>JQ669822.1-DREB6-1.m1 ID=JQ669822.1-DREB6-1.m1|Name=DREB6-1|organism=Malus x domestica|type=mRNA|length=1353bp
back to top

protein sequence of DREB6-1

>JQ669822.1-DREB6-1.p1 ID=JQ669822.1-DREB6-1.p1|Name=DREB6-1|organism=Malus x domestica|type=polypeptide|length=450bp
back to top

mRNA from alignment at JQ669822:1..1353+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ669822.1-DREB6-1.m1 ID=JQ669822.1-DREB6-1.m1|Name=DREB6-1|organism=Malus x domestica|type=mRNA|length=1353bp|location=Sequence derived from alignment at JQ669822:1..1353+ (Malus x domestica)
atgtcttcaccaaaaaagagtggtaagtctaagatggagacaagcggaga atgggaggcgaacaaagacaaggagcttgatttttccttcgagagaccgc catggaagcccggttttagtgaggcttcaacggcgtcgaataggcctctc aagaaagtcaagagccctgaaaggcaagacccaattcaagcttcaccttc tttagatcatcatcaaacaccttcgccaatcattgctccccatccatctt attcctcttcaaaaatagtgtttcctttttctttcgacgggtctcaacag cctatgatgcaattcccccaccagttcaaccccacaaatttgcctatgtt tccctcacccattcaacagcaactgcaacaaaatcctcagcaaatgattt cttttgaatcccagcagcagcagccgcagcagcagcaggggatgagttat ccactgccgtttgtcggagagtcggtgagttggcagcagcaccagaaaat gcttcagcattggagtgacgctttaaatttgagtccaagagggagggtga tgatgaacaggttgggaccagatggcaggccaatgtttcgacccccggca atgccttataatactacaaaactttacagtggagtgaggcaacggcattg gcgcaaatgggtagctgaaatccgccttcctcgaaacaggactcgcctct ggcttggcaccttcgacacagctgaagatgccgccatggcttacgaccgc gaggccttcaagttgagaggagagaatgccaggctcaatttccctgagct ttttctcaacaaagacaaatcagatgtttcagtttcatcagctccgagtt cagctgctacttcgcctccaaggcatgagggttcaaaaccaaccaggaac cgcaagcaacctcaaaaaatcaagagcagcgcttcgaatatagaggcaat gccaccgccaccaattccacatacccaagaagagaatagtcctgacaatg attcaggactggagtcgaacgaggctaaagcgattgacgaagttgaggtg aatatcgatggtgctggaggagggagttcacagcaaaaggaaattgtttg gggggatatggcagaagattggcttaatgcaattcctgcaggttggggtc caggtagtcctgtgtgggatgatttggacaacaatcttttgctgcaatca catctcccttttaccaatccaaaccagcaggactataacattaacattaa tcctcaacaagcgattcagaattcaggttcgggttcgggatctggttcct cttcttcctcttcatatcccacgaagaacctcttttggaaggaccaggat tga
back to top

Coding sequence (CDS) from alignment at JQ669822:1..1353+

>JQ669822.1-DREB6-1.m1 ID=JQ669822.1-DREB6-1.m1|Name=DREB6-1|organism=Malus x domestica|type=CDS|length=1353bp|location=Sequence derived from alignment at JQ669822:1..1353+ (Malus x domestica)
back to top