DREB5-1, JQ669820.1-DREB5-1.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameJQ669820.1-DREB5-1.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB5-1DREB5-1Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ669820.1-DREB5-1.m1-cds1JQ669820.1-DREB5-1.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB5-1JQ669820.1-DREB5-1.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ669820 region JQ669820:1..606+ NCBI Rosaceae gene and mRNA sequences
Chr15 chromosome Chr15:49614193..49614798+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr15 chromosome chr15:40717682..40718287- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr15 chromosome chr15:40717624..40718229- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr15 chromosome chr15:40726295..40726900- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr15 chromosome chr15:47453782..47454387- Malus x domestica Whole Genome v1.0p Assembly & Annotation
chr15 chromosome chr15:47445111..47445716- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productdehydration-responsive element-binding protein (DREB5)
The following sequences are available for this feature:

mRNA sequence

>JQ669820.1-DREB5-1.m1 ID=JQ669820.1-DREB5-1.m1|Name=DREB5-1|organism=Malus x domestica|type=mRNA|length=606bp
back to top

protein sequence of DREB5-1

>JQ669820.1-DREB5-1.p1 ID=JQ669820.1-DREB5-1.p1|Name=DREB5-1|organism=Malus x domestica|type=polypeptide|length=201bp
back to top

mRNA from alignment at JQ669820:1..606+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ669820.1-DREB5-1.m1 ID=JQ669820.1-DREB5-1.m1|Name=DREB5-1|organism=Malus x domestica|type=mRNA|length=606bp|location=Sequence derived from alignment at JQ669820:1..606+ (Malus x domestica)
atggaatcccaggctgcagactgccgcgtctctccggcaagatacaaagg agttcgcaagcgaaaatggggcaaatgggtgtccgaaatccgcgaaccag gaaagaaaaccagaatatggctaggaagctacgaggcaccagaaatggca gctgcggcctatgatgcagcggcattgcacctcaaagggtgtggggcggc gcttaattttcctgaaatggctgatagtcttccgaggccggccagttcaa gcgcaatggacgtgcaactagcggctcaagaggctgcattgagggttaga cgacagcagctgccaatggaggcatttccaaaggaggaggtgggtggctc gtcgaggggtttgagctcagcgccagtgacggtgggactgtctccgagtc aaatccaggcgattaatgagtcgccgttggactcgccaaagatgtggatg cagtacatgtgcagggctcattgccatgaggctccgtcgtcgttaggggg agacctgtgggacactgataattccagtccaaacaagtactatgaaggtg atgtcgagtcaatggactacgaagatatgcagcattggtccatttgggat ccctag
back to top

Coding sequence (CDS) from alignment at JQ669820:1..606+

>JQ669820.1-DREB5-1.m1 ID=JQ669820.1-DREB5-1.m1|Name=DREB5-1|organism=Malus x domestica|type=CDS|length=606bp|location=Sequence derived from alignment at JQ669820:1..606+ (Malus x domestica)
back to top