DREB2-4, JQ669819.1-DREB2-4.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameJQ669819.1-DREB2-4.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB2-4DREB2-4Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ669819.1-DREB2-4.m1-cds1JQ669819.1-DREB2-4.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB2-4JQ669819.1-DREB2-4.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ669819 region JQ669819:1..1476+ NCBI Rosaceae gene and mRNA sequences
Chr04 chromosome Chr04:25592876..25596077- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr4 chromosome chr4:16514923..16518124+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr4 chromosome chr4:18683820..18687021- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Property NameValue
Productdehydration-responsive element-binding protein (DREB2)
The following sequences are available for this feature:

mRNA sequence

>JQ669819.1-DREB2-4.m1 ID=JQ669819.1-DREB2-4.m1|Name=DREB2-4|organism=Malus x domestica|type=mRNA|length=1476bp
back to top

protein sequence of DREB2-4

>JQ669819.1-DREB2-4.p1 ID=JQ669819.1-DREB2-4.p1|Name=DREB2-4|organism=Malus x domestica|type=polypeptide|length=491bp
back to top

mRNA from alignment at JQ669819:1..1476+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ669819.1-DREB2-4.m1 ID=JQ669819.1-DREB2-4.m1|Name=DREB2-4|organism=Malus x domestica|type=mRNA|length=1476bp|location=Sequence derived from alignment at JQ669819:1..1476+ (Malus x domestica)
atggagtccgaggcttcggacggggaaaggaaattgcggaagaggcgcaa cgggtgcgaatcgatagaggacacactgaccaagtggaagaactacaatg agaggcttgattctgggaaagatggagggaagaagactcgggctccggcg aagggctccagaaaaggctgcatgagggggaaaggagggccggagaactc agattgtgtatttaggggtgttaggcagaggacttggggaaaatgggtgg cggaaattcgagaaccaattcgagctagagccggttctgtacctacgaag aagaataggcgtctttggcttggtactttccctacagcctatgaagctgc tcttgcttatgataaagctgctagagcaatttatggtgctttggcccggc tcaacttccccgacaatgctgtggactcgaaggactactactctaattct gtgtcatctaaaacaccatcgtcgcatgagtcctcattgacatacaataa tgcggatgaggcagggggaagatcaggattctttgaggattgtgtggcca aagagcaaaagcaggaaacggattgttctgtatcagaggaattacatgtt ttacgtgctacctcaagagaaccaaaagctgtgaaatgtgaatacgaaac tgaacgtgagcttgttaagaacgatgatgtttttcagaccgagagctatg gaagcttcgatcataggggagattacttgcctaatgagcccctggttgtg aattttgatacggtatttgattgtaagccttgtaacgatatggatccttt ggagaaacttttgaggtccaattatgattacttaactgagcttgtagatg gggaatgcaatcggagaaacagttgcaagccttcaaatgatgtcaaagtt gagacaccggcaatgagggaagccgcggagaaaccatttccggtgattct ggaatccggaagtcacaacgggttagatgagaagtacaacaacatacatg gtgagcaaataaacgcggccgaaattcttgtaaccaattttgagccttct gaggatgttgaaatgaagttatcgatgacgaatcaagaattgcaaggagg atttgcagaaacaacgagattagatggccataattgcaatggcttcatac atagttatgcttgtttagatgatttagatgtggcatacggtccgagatat ggcattaatccttggaatgatatcggaatgcagacagagctcgacgacag acttgactacgtgcataactggtctgcagaggaaacctatggcattgatg ctgctgaggaccaacaatgggggaggacgcataatctccctattcagttg cagacacaaccacatcccgacatacctggaagctcgaatcacacggagta cgcacatttaggcgtggatatcgatcgacaaagttacgattctggtgcaa tggaagagcaggggctgcctaaatga
back to top

Coding sequence (CDS) from alignment at JQ669819:1..1476+

>JQ669819.1-DREB2-4.m1 ID=JQ669819.1-DREB2-4.m1|Name=DREB2-4|organism=Malus x domestica|type=CDS|length=1476bp|location=Sequence derived from alignment at JQ669819:1..1476+ (Malus x domestica)
back to top