COX1, EU701209.1-COX1.m1 (mRNA) Rubus occidentalis

Transcript Overview
Unique NameEU701209.1-COX1.m1
OrganismRubus occidentalis (Black raspberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1EU701209.1-COX1Rubus occidentalisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1COX1Rubus occidentalisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU701209.1-COX1.m1-cds1EU701209.1-COX1.m1-cds1Rubus occidentalisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
COX1EU701209.1-COX1.p1Rubus occidentalispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU701209 region EU701209:1..655+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productcytochrome oxidase subunit 1
The following sequences are available for this feature:

mRNA sequence

>EU701209.1-COX1.m1 ID=EU701209.1-COX1.m1|Name=COX1|organism=Rubus occidentalis|type=mRNA|length=655bp
back to top

protein sequence of COX1

>EU701209.1-COX1.p1 ID=EU701209.1-COX1.p1|Name=COX1|organism=Rubus occidentalis|type=polypeptide|length=218bp
back to top

mRNA from alignment at EU701209:1..655+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU701209.1-COX1.m1 ID=EU701209.1-COX1.m1|Name=COX1|organism=Rubus occidentalis|type=mRNA|length=655bp|location=Sequence derived from alignment at EU701209:1..655+ (Rubus occidentalis)
ggatatagggactctatatttcatcttcggtgctattgctggagtgatgg gcacatgcttctcagtactgattcgtatggaattagcacgacccggcgat caaattcttggtgggaatcatcaactttataatgttttaataacggctca cgcttttttaatgatcttttttatggttatgccggcgatgataggtggat ttggtaattggtttgttccgattctgataggtgcacctgacatggcattt ccacgattaaataatatttcattctggttgttgccaccaagtctcttgct cctattaagctccgccttagtagaagtgggtagcgggactgggtggacgg tctatccgcccttaagtggtattaccagccattctggaggagctgttgat ttagcaatttctagtcttcatctatctggtgtttcatccattttaggttc tatcaattttataacaactatcttcaacatgcgtggacctggaatgacta tgcatagattacccctatttgtgtggtccgttctagtgacagcattccta cttttattatcacttcccgtactggcaggggcaattaccatgttattaac cgatcgaaactttaatacaaccttttttgatcccgctggggggggagacc ccata
back to top

Coding sequence (CDS) from alignment at EU701209:1..655+

>EU701209.1-COX1.m1 ID=EU701209.1-COX1.m1|Name=COX1|organism=Rubus occidentalis|type=CDS|length=655bp|location=Sequence derived from alignment at EU701209:1..655+ (Rubus occidentalis)
back to top