VPE, VPE (gene) Malus sikkimensis

Gene Overview
Name VPE
Gene Symbol VPE
Type gene
Organism Malus sikkimensis
Synonym vacuolar processing enzyme
Description NA
Comment peptidase C13 family; asparaginyl peptidase family
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
VPEJQ666195.1-VPE.m1Malus sikkimensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
vacuolar processing enzymeVPEMalus sikkimensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ666195.1-VPE.m1 chr15:965932..969041
chr15:950582..953693
chr15:965933..969042
JQ666195.1

Sequence(s):
>JQ666195.1-VPE.m11485
atgactcggttggccagcgccgtcgtcctcctatttttcgcctccgtcttggcttccgcagccggtagccgggacctgat
cggagacattttgcgattaccgtcggaagcttccaaattcttcgggagaggcgatgatgctcccgatcaacaagacgacg
gcaccgtcgggaccaggtgggctgttctgatcgccggctccaatggatactggaattacaggcatcaggctgatatttgt
cacgcctatcaactactgaagaaaggtgggttgaaagatgaaaacatcgttgtattcatgtacgatgatattgcttacaa
tgaagagaacccgaggcaaggagtcatcattaacagcccgcatgggagtgacgtttacgaaggagttccaaaggattaca
ctggggaagatgttactgtgaacaacttttttgctgctatccttgggaataaaactgctctgaccgggggtagtgggaag
gttgtggatagcggtccaaatgatcatattttcatatactacaccgatcatggtggtcctggaattcttgggatgccaac
tagtccttatatttatgctaacgatctgatagaagtcctgaagaagaagcatgctgccggaacctataaaagcttggtat
tttatctggaagcttgtgaatctggaagtatcttcgagggtcttcttccggaaggtttgaatatctttgcaaccactgca
tcgaatgcagaagagagcagttggggaacttactgccctggagagtatcctagtcctcccccagaatacgatacctgctt
gggtgacttgtatagtgttgcttggatggaagacagtgacgtacacaacttgaggtcagaaactttgcaccagcaatatg
aactggttaaaacgaggacagccaacgacaattctggatttggttctcatgtcatgcaatacggcgatgtagggctcagc
aagaacaacctctttgtgtacatggggacaaatcctgcaaatgacaaccatacttttctgggagagaactccttgaggcc
atcttcaaaagctgtcaaccagcgcgatgctgatcttcttcatttctggcataagtatcgtaaggctcccgaaggctcgg
caaggaaaattcaagctcaaaaggattttgttgaagcaatgtctcacagaatgcacatagatcagaccatgaagctgatt
gggaaactcctgttcggaattgaaaaaggcccacaagtactcaatgctgttcgacctgctgggcagccgcttgttgatga
ctgggactgccttaagacaatggtgaggagttttgagacgcattgtggatccctatcgcaatacgggatgaaacacatgc
gttccctggcaaacatctgcaacgccggaatgacacaggatcagatggccgaggcttcagcacaagcctgcgtgagcgcc
ccctctggtcgctggagctccctgcaccggggattcagtgcgtga
back to top