GAPDHB, JQ302965.1-GAPDHB.m1 (mRNA) Pyrus x bretschneideri

Transcript Overview
Unique NameJQ302965.1-GAPDHB.m1
OrganismPyrus x bretschneideri ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHBGAPDHBPyrus x bretschneiderigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ302965.1-GAPDHB.m1-cds1JQ302965.1-GAPDHB.m1-cds1Pyrus x bretschneideriCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDHBJQ302965.1-GAPDHB.p1Pyrus x bretschneideripolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JQ302965 region JQ302965:18..1376+ NCBI Rosaceae gene and mRNA sequences
scaffold00605 supercontig scaffold00605:82069..84677- Pyrus communis Genome v1.0 Draft Assembly & Annotation
Property NameValue
Productglyceraldehyde-3-phosphate dehydrogenase B
The following sequences are available for this feature:

mRNA sequence

>JQ302965.1-GAPDHB.m1 ID=JQ302965.1-GAPDHB.m1|Name=GAPDHB|organism=Pyrus x bretschneideri|type=mRNA|length=1359bp
back to top

protein sequence of GAPDHB

>JQ302965.1-GAPDHB.p1 ID=JQ302965.1-GAPDHB.p1|Name=GAPDHB|organism=Pyrus x bretschneideri|type=polypeptide|length=452bp
back to top

mRNA from alignment at JQ302965:18..1376+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ302965.1-GAPDHB.m1 ID=JQ302965.1-GAPDHB.m1|Name=GAPDHB|organism=Pyrus x bretschneideri|type=mRNA|length=1359bp|location=Sequence derived from alignment at JQ302965:18..1376+ (Pyrus x bretschneideri)
atggcctcacacgcagctctcgcctcttcgcgagtcccggctaacaccag gcttccctccaagccctcccactcatttcccacccaatgcttctccaaga ggcttgaagttggtgagttttcaggactaagatcgagttcatgtgtgacc tatgcaagcaatggcagagagcaatccttcttcgatactgtcgctgccca gcttactcccaagactgcaggaccaactcctgtcaggggagaaacagtgg caaaattgaaggtggcaatcaacggatttggacgtattggcagaaacttc ctccgatgctggcatggccgcaaggactcacccctcgaagtcattgttgt taatgacagtggtggtgtcaagaatgcttcacacttgctgaaatacgact caatgctgggtactttcaaagcagatgtgaaaatcgttgacaatgagacc atcagcgttgatggtaagcccgtcaaggttgtctctagcagagatcccct gaagcttccatgggctgagatgggcattgacattgttatcgagggaacag gagtctttgtcgatggccctggtgccggcaaacatatccaagccggtgcc aagaaagtcatcattacagctccagcaaaaggtgctgacattcctacaca tgttgtcggggtgaatgaaaaagactacggccacgacgttgccaacattg taagcaatgcttcttgcaccacaaactgcctggctcctttcgtaaagatc ctggatgaagaatttggcattgtcaagggaaccatgacaactactcattc ctacactggagaccagaggctcttggacgcttcacaccgggacttaagga gagccagagcggcagcactaaacatagtccccacaagcactggtgcagca aaggctgtgtcccttgtgctgcctcaactcaaaggcaagctcaacggcat tgccctccgtgtgccaacacctaacgtatcagtggttgaccttgtgatca acgttgcaaagaaaggtatttcagcagaagatgtcaatgcagccttcaga aaggcagcggacggaccacttaagggcatattggcagtgtgcgacgttcc tcttgtgtctgtggacttcaggtgcactgatgtttcctccaccatagact cctccttgaccatggtcatgggtgatgatatggtcaaggtggtggcctgg tacgacaacgaatggggatacagccaaagggttgtggatttggcacattt ggttgcaagcaagtggccaggcgcggcagtagtgggaagcggagacccat tggaggatttctgccagacaaacccggcagacgaggagtgcaaagtctat gaagcatag
back to top

Coding sequence (CDS) from alignment at JQ302965:18..1376+

>JQ302965.1-GAPDHB.m1 ID=JQ302965.1-GAPDHB.m1|Name=GAPDHB|organism=Pyrus x bretschneideri|type=CDS|length=1359bp|location=Sequence derived from alignment at JQ302965:18..1376+ (Pyrus x bretschneideri)
back to top