XET01, XET01 (gene) Malus x domestica

Gene Overview
Name XET01
Gene Symbol XET01
Type gene
Organism Malus x domestica
Synonym xyloglucan endotransglycosylase
Description NA
Comment MdXET01
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XET01AY144593.1-XET01.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglycosilaseXETMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY144593.1-XET01.m1 Chr16:11186408..11188514
chr4:6878951..6881056
chr4:7671441..7673546
AY144593.1

Sequence(s):
>AY144593.1-XET01.m1885
atggcttcttgcaaacaatggactgtgtttttgagtttgctgtgtttggtctctgcaacagtggcagctcccccgaaaaa
gccagttgcggtgccgtttggcagaaactacatgcccacttgggcttttgatcacatcaagtacttcaatggaggcaaag
agatccagttgcatctcgacaaatacacaggtactggctttcaatcaaaaggaaattacttgtttggccacttccatatg
caaattaagatggttcctggggattctgctggaactgttactgcttattatctgtcttcacaaaacaacgaacacgacga
gatcgatttcgagttcttggggaacaggacaggacagccatacattctgcagaccaatgtgttcacgggtggaaaggggg
atagagagcagaggattttcctctggttcgaccctactgcagcttaccactcctacgccgtcctctggaatctctatcag
attgtattcttggtggacgacataccgatcagggtgttcaagaacagcaaagatttgggtgtgaaattcccatttaacca
gcccatgaagctctactccagcctgtggaacgcagacgattgggctaccaggggtggtctggaaaagaccgactggtcca
aggctccgttcatcgctagctaccggggcttccacatcgacgggtgcgaggcctccgtcgaagccaagtattgtgccacc
cagggtaagagatggtgggaccagaaggagttccaagaccttgatgctcagcaatggagaaggctgaggtgggtccgcaa
gaaattcaccatctacaactactgcactgaccgagtcagatacccttctatgccaccagagtgcaagagggacagagaca
tataa
back to top