XET02, XET02 (gene) Malus x domestica

Gene Overview
Name XET02
Gene Symbol XET02
Type gene
Organism Malus x domestica
Synonym xyloglucan endotransglycosylase
Description NA
Comment MdXET02
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XET02AY144594.1-XET02.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglycosilaseXETMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY144594.1-XET02.m1 Chr13:24139435..24140817
chr10:17693817..17695201
chr10:20238303..20239687
AY144594.1

Sequence(s):
>AY144594.1-XET02.m1849
atgactaagatattccttgttctagtacttctggtgttcaatgttttggtggcgacgtcggccggaaacttcaaccaaga
ttttgacataacatggggcgatggtcgggcaaaaatactcgacaacgggcagagtcttacgctgtccctggacaagacat
cagggtcggggtttcagtcgaagaatcagtacttgttcggaaaaattgatatgcagataaagcttgtgcctggtaactct
gctggcacggttacagcttactatctatcatcattgggttctactcatgacgaaatagacttcgagtttctaggcaacct
aagtggagacccttatattctgcacacaaatattttcacacaagggaaggggaatagggagcaacagttctacctttggt
ttgatcccaccaaagacttccatacctactccatcttgtggaaccctcaaaccatcatcttctcagtagatggaacaccc
attagagagttcaagaacttagaatctaagggagtctctttcccaaaggaccaaggcatgtggatatactcaagcctatg
gaatgcagacgattgggccacacgcggcggacttgtgaagacggattggagcaaagcccccttcacagcctcctacagaa
acttcaacgcccaagcttgcacttggtcttcaggcacttcccgttgtccttcaaagtccccgaacgagtcgagctggtta
actcagtcactcgattccacagggcaagagagaatcaaatgggttcagaagaactacatgatttacaactactgcagaga
taccaagcgcttcccgcaaggatttcctcctgagtgctctgctgcgtga
back to top