XET2, XET2 (gene) Pyrus x bretschneideri

Gene Overview
Name XET2
Gene Symbol XET2
Type gene
Organism Pyrus x bretschneideri
Synonym xyloglucan endotransglycosylase 2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XET2KC855757.1-XET2.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglycosilaseXETPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KC855757.1-XET2.m1 scaffold00052:321440..322829
KC855757.1

Sequence(s):
>KC855757.1-XET2.m1849
atgactaagatattccttgttctagtacttttggtgttcaatgttttggtgacggcatcggccggaaacttcaaccaaga
ttttgacataacatggggcgatggtcgggcaaaaatactcgacaacgggcagagtcttacgctgtccctggacaagacat
cagggtcggggtttcggtcgaagaatcagtacttgtttggaaaaattgatatgcagataaagcttgtgcctggtaactct
gctggcaccgttacagcttactatctgtcgtcgttgggttctactcatgacgaaatagacttcgagtttctaggcaacct
aagtggagacccttatattctgcacacaaatgttttcacgcaagggaaggggaatagggagcaacagttctacctttggt
ttgatcccaccaaagacttccatacctactccatcttgtggaaccctcaaaccatcatcttctctgtggatggaacaccc
attagagagttcaagaacttggaatctaagggagtctctttcccaaaggaccaaggcatgtggatatactcaagcctatg
gaatgcagacgattgggccacacgcggcggacttgtgaagacggattggagcaaagcccccttcacagcctcctacagaa
acttcaacgcccaagcttgcacttggtcttcaggcacttcccgttgtccttcagagtccccgaacgagtcgagctggtta
actcagtcactcgattccacagggcaagagagaatgaaatgggttcagaagaactacatgatttacaactactgcagaga
taccaagcgcttcccacaaggatttcctcctgagtgctcggctgcatga
back to top