XET, XET (gene) Pyrus communis

Gene Overview
Name XET
Gene Symbol XET
Type gene
Organism Pyrus communis
Synonym xyloglucan endotransglycosilase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XETAJ811689.1-XETPyrus communisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XETAJ811689.1-XET.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglycosilaseXETPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AJ811689.1-XET scaffold00807:865..1208
AJ811689.1
mRNA parsed from NCBI nr database AJ811689.1-XET.m1 scaffold00807:865..1208
AJ811689.1

Sequence(s):
>AJ811689.1-XET342
atgaagctctactccagcctgtggaacgcagacgattgggctactcggggtggtctggaaaagaccgattggtccaaggc
cccgttcatcgccagctaccggggcttccacatcgacggctgcgaggcctccgtcgaagccaagttttgtgccacccagg
gtaagaggtggtgggaccagaaggagttccaagaccttgatgctcagcaatggaggaggctgaggtgggtccgaaggaaa
ttcaccatctacaactactgcatgaccgagtcagatacccttctatgccaccggagtgcaagagggacagagacatataa
accaagagtaaattatgattag
back to top
>AJ811689.1-XET.m1342
atgaagctctactccagcctgtggaacgcagacgattgggctactcggggtggtctggaaaagaccgattggtccaaggc
cccgttcatcgccagctaccggggcttccacatcgacggctgcgaggcctccgtcgaagccaagttttgtgccacccagg
gtaagaggtggtgggaccagaaggagttccaagaccttgatgctcagcaatggaggaggctgaggtgggtccgaaggaaa
ttcaccatctacaactactgcatgaccgagtcagatacccttctatgccaccggagtgcaagagggacagagacatataa
accaagagtaaattatgattag
back to top