XET, XET (gene) Rosa chinensis

Gene Overview
Name XET
Gene Symbol XET
Type gene
Organism Rosa chinensis
Synonym xyloglucan endotransglycosylase
Description NA
Comment RcXET
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglycosilaseXETRosa chinensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XETGU320707.1-XET.m1Rosa chinensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU320707.1-XET.m1 N/A GU320707.1

Sequence(s):
>GU320707.1-XET.m1885
atggcttcttacaagcaatggactctgctcttgagcttagtgcttatggtctctgcaacaatggcagctcccccaaggag
gcctgtggctgtaccctttggaagaaactaccagcccacctgggcttttgaccacatcaagtactacaatggtggcaatg
agattcagctccaccttgacaaatacacaggtacgggtttccaatccaaaggttcatacttgtttggccatttccatatg
caaatcaaactggtccctggtgactctgctggaactgttactgctttctatctgtcttctacaaactcagagcacgatga
gatcgacttcgagttcttggggaacagaacagggcagccctacattttgcagactaatgtcttcaccggaggaaagggtg
accgagaacagaggatcttcctctggttcgacccaaccaaagagtaccactcctactctgtgctctggaatctctaccag
attgtattcttagtggatgacatcccaatccgagtcttcaagaacagcaaagacttgggagtgaaattcccattcaacca
acccatgaagctctactctagtctgtggaacgcagacgattgggccaccaggggaggactcgagaagactgactggtcta
aggctcccttcgtggccacctataggggcttccatatcgacggctgcgaggcgtcggtggaagccaagtactgtgccact
cagggtaagaggtggtgggatcagaaggagttccaggacctcgatgcttatcaatggaggaggctgaggtgggttagaca
gaggttcaccatctacaactactgcactgacaggactaggtaccctagtctccctgccgagtgcaagagagacagagaca
tatga
back to top